|
ATCC
caption a7 strain pae Caption A7 Strain Pae, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/yWXD489/pmc00201171-107-28-46 Average 90 stars, based on 1 article reviews
caption a7 strain pae - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 species strain mic Caption A7 Species Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/MIC/pmc00090018-140-30-48 Average 99 stars, based on 1 article reviews
caption a7 species strain mic - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
t5 caption a7 strain T5 Caption A7 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/A7/pmc03426712-247-19-66 Average 96 stars, based on 1 article reviews
t5 caption a7 strain - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440 ![]() Caption A7 Recipient Strain Mobilization Frequency B Pnit6012 Pnit101 P Putida Kt2440, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Aspergillus+tamarii+Kita%2C+anamorph/pmc05165122-304-24-68 Average 94 stars, based on 1 article reviews
caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc ![]() Caption A7 Source Organism J Denitrificans Strain Atcc 14870 Dna Source Synthetic Dna Forward Primer 5 Ccgtagcaat Ggatcc Atgaagaagagaaagttgagagcgtcagc, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Jonesia+denitrificans+(Prevot)+Rocourt+et+al/pmc04631597-97-20-27 Average 94 stars, based on 1 article reviews
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain mic ![]() Caption A7 Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Rhizopus+oryzae+Went+et+Prinsen+Geerligs/pmc05740350-266-27-52 Average 94 stars, based on 1 article reviews
caption a7 strain mic - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain ![]() Caption A7 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Plasmid/pmc00154081-134-50-64 Average 99 stars, based on 1 article reviews
caption a7 strain - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc ![]() Caption A7 S Pneumoniae Strain Pae H Telithromycin Jnj 1 Jnj 2 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Streptococcus+pneumoniae/pmc00538878-233-73-85 Average 95 stars, based on 1 article reviews
caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain genotype strain description bb120 atcc baa ![]() Caption A7 Strain Genotype Strain Description Bb120 Atcc Baa, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Vibrio+campbellii%3B+BB120/pmc05086544-100-22-29 Average 96 stars, based on 1 article reviews
caption a7 strain genotype strain description bb120 atcc baa - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 mic ![]() Caption A7 Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Streptococcus+pyogenes+Rosenbach/pmc07236257-92-92-123 Average 95 stars, based on 1 article reviews
caption a7 mic - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
ATCC
t5 caption a7 species strain concn ![]() T5 Caption A7 Species Strain Concn, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Streptococcus+pyogenes+Rosenbach/pmc03535986-418-31-42 Average 99 stars, based on 1 article reviews
t5 caption a7 species strain concn - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
strain no of volunteers tested ubt ![]() Strain No Of Volunteers Tested Ubt, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+pae/Aspergillus+auratus+Warcup%2C+anamorph/pmc00090863-268-60-84 Average 93 stars, based on 1 article reviews
strain no of volunteers tested ubt - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Deletion derivatives of the oriTN region and their mobilization. The numerals at both ends of each fragment are the nucleotide positions in the 430-bp oriTN region. Four predicted IRs with hairpin loop structures (see Fig. 1c) are indicated by different colored boxes, DRs are indicated by arrows, and the putative IHF-binding site is depicted as a red box. The frequencies of mobilization of pNIT101 to pNIT114 from G7(NAH7K3) to KT2400Gm are expressed by the numbers of the Tcr transconjugants per donor cell. Each frequency is the mean value obtained from at least three independent experiments. Statistical analysis was performed using the t test: statistical significance (P < 0.05) in comparison with pNIT101 (*) and with pNIT104 (**).
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Binding Assay, Comparison
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Conjugative transfer and mobilization of plasmids a
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation, Clone Assay
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Mobilization of oriT N -containing plasmid to various bacterial strains a
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Bacterial strains and plasmids used in this study
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation, Over Expression
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Primers used in this study
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Sequencing, Cloning, Amplification
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase
doi: 10.1107/S2053230X15019743
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Details of the cloning and protein-production procedures are summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Produced
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Antibacterial activities of erythromycin A, telithromycin, JNJ 1, and JNJ 2
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Inhibition of protein synthesis by erythromycin A, telithromycin, JNJ 1, JNJ 2, and ampicillin
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques: Inhibition
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Decrease in bacterial counts of macrolide-susceptible and -resistant pneumococci after treatment with telithromycin, JNJ 1, or JNJ 2
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: PAE of telithromycin, JNJ 1, and JNJ 2 on S. pneumoniae isolates
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques: