Journal: Cell metabolism

Article Title: Ketogenesis promotes tolerance to Pseudomonas aeruginosa pulmonary infection.

doi: 10.1016/j.cmet.2023.09.001

Figure Lengend Snippet: Figure 6. Itaconate promotes ketone enrichment in the lung during P. aeruginosa infection (A–L) Irg1+/+ and Irg1/ mice were exposed to PBS, WT PAO1, or the P. aeruginosa isolates. The following were measured: (A) and (B) BAL metabolites; (C) mRNA expression of ketogenic clusters in each lung cell subset identified by scRNA-seq; (D) volcano plot of Dketogenesis scores (‘‘Irg1+/+’’–‘‘Irg1/’’) for each lung cell subset during infection with the P. aeruginosa isolates; (E) ketogenesis transcriptomic score in fibroblasts; (F) expression of ketogenic clusters in fibroblasts; (G) BAL FGF21; (H)–(I) respiratory pathogen burden during infection with the P. aeruginosa isolates; (J) animal survival; (K) BAL cytokines; and (L) weight change. Data are shown as average ± SEM from 2 to 3 independent experiments, with 3–10 animals in total. (A), (B), (E), and (G)–(I): one-way ANOVA; (L): two-way ANOVA; (D): Student’s t test. (J): Kaplan-Maier. *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001; ns, non-significant. See also Figures S5 and S6, Table S2, and Data S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: C57BL/6 Jackson Laboratories JAX: 000664 Mouse: C57BL/6J/N Jackson Laboratories JAX: 005304 Mouse: C57BL/6 Irg1 / (Acod1 / ) Jackson Laboratories JAX: 029340 Mouse: B6.129S7-Il1r1tm1Imx/J (Il1r / ) Jackson Laboratories JAX: 003245 Bacterial and virus strains P. aeruginosa WT PAO1 Our laboratory N/A P. aeruginosa WT PAO1 Provided by Dr. CJ Balibar; Balibar and Grabowicz38 N/A P. aeruginosa DlptD PAO1 (mutant 4213) Provided by Dr. CJ Balibar; Balibar and Grabowicz38 N/A CF subject 2 P aeruginosa isolates Riquelme et al.32 N/A CF subject 1 P aeruginosa isolates Provided by Dr. Barbara Kahl N/A ICU P. aeruginosa isolates Provided by Dr. A.C. Uhlemman N/A Oligonucleotides rpsL-F: CGGCACTGCGTAAGGTATGC Riquelme et al.32 N/A rpsL-R: CGTACTTCGAACGACCCTGCT Riquelme et al.32 N/A lptD-F: CCTGCCCTACAACCCAGGTG Riquelme et al.32 N/A lptD-R: ATGCTGCCGTCGTCATTGAA Riquelme et al.32 N/A waaL-F: CTACGCCAGATCAGCGAGCA Riquelme et al.32 N/A waaL-R: CCTCCAGCGAAAAGCACACC Riquelme et al.32 N/A wbpX-F: GAGACCATCCGCGACGAAGT Riquelme et al.32 N/A wbpX-R: TCCTCCACCAGGTCCAGCTC Riquelme et al.32 N/A wbpZ-F: GCTCCGCCAGTACCGAGAAA Riquelme et al.32 N/A wbpZ-R: ATCACCCCGACGAACAGGAA Riquelme et al.32 N/A lpxT-F: CTGACCTTCGGCTTCATCGT Nowicki et al.65 N/A lpxT-R: TGGAGCGGTCCTTGATTTCC Nowicki et al.65 N/A arnT-F: GGCTATGCCAACCTCGACCC Nowicki et al.65 N/A arnT-R: GCGAGGAAGCCCTTGGTCAG Nowicki et al.65 N/A Software and algorithms GraphPad Prism 9 GraphPad Software https://www.graphpad.com/ FlowJo X Flow cytometry FlowJo https://www.flowjo.com FIJI FIJI http://imagej.net Seurat v4, Seurat v5 Seurat library https://satijalab.org MetaboloAnalyst 5.0 MetaboloAnalyst https://www.metaboanalyst.ca Kyoto Encyclopedia of Genes and Genomes KEGG https://www.genome.jp/kegg/ Adobe Photoshop 24.5.0 Adobe https://www.adobe.com/ Deposited data scRNA-seq lung tissue GEO Access number: GSE203352 Raw metabolomics BAL tissue MetaboLights Access numbers: MTBLS4922, MTBLS4923, and MTBLS4924 P. aeruginosa isolates genomes NIH SRA Access numbers: PA270 (SRR8775051), PA338 (SRR8775050), PA339 (SRR8775058), PA599 (SRR8775057), PA600 (SRR8775065), PA601 (SRR8775054), PA602 (SRR8775055), PA603 (SRR8775053), PA604 (SRR8775056), PA605 (SRR8775052), PA606 (SRR8775060), PA607 (SRR8775059), PA608 (SRR8775062), PA683 (SRR8775061), PA684 (SRR8775064), PA685 (SRR8775063) and PA686 (SRR8775066).

Techniques: Infection, Expressing

Journal: PLoS pathogens

Article Title: Virion assembly factories in the nucleus of polyomavirus-infected cells.

doi: 10.1371/journal.ppat.1002630

Figure Lengend Snippet: Figure 6. Tubular structures contain VP1. PyV-infected 3T3 cells or PML2/2 MEFs (MOI of 10–20 pfu/cell) at 32 hpi were frozen by high pressure and processed by cryo-substitution for immunoelectron microscopy. Thin sections (45 nm or 70 nm) of Lowicryl-embedded samples were stained with either anti-PML or anti-VP1 antibodies followed by a secondary antibody conjugated to 10 or 15 nm colloidal gold. Top panels: 45 nm sections stained for the PML protein; white arrows, anti-PML staining, black arrow, tubular structures. Bottom panels: 70 nm sections stained for VP1; white arrows, anti-VP1 staining, black arrows, tubular structures. doi:10.1371/journal.ppat.1002630.g006

Article Snippet: C57 mouse embryonic fibroblasts (MEF) were obtained from ATCC (SCRC-1008; Manassas, VA) and served as a wild-type MEF control.

Techniques: Infection, Immuno-Electron Microscopy, Staining

Journal: PLoS pathogens

Article Title: Virion assembly factories in the nucleus of polyomavirus-infected cells.

doi: 10.1371/journal.ppat.1002630

Figure Lengend Snippet: Figure 7. PyV DNA and T-antigen localization in PyV-infected PML2/2 MEFs. PML2/2 MEFs were infected with PyV at an MOI of 30–40 pfu/ cell. At 22 or 24 hpi cells were fixed, permeabilized, and co-stained with either anti-Tag and/or anti-MRE11a antibodies followed by AlexaFluor- conjugated secondary antibodies, a fluorescently-labeled PyV DNA FISH probe, and DAPI staining of nuclei. A) FISH for PyV DNA at 24 hpi followed by antibody staining for Tag. B) Infected cells were stained by FISH for PyV DNA at 22 hpi followed by antibody staining for MRE11 or co-stained for MRE11 and Tag. All images represent a 0.1 mm z-stack slice. doi:10.1371/journal.ppat.1002630.g007

Article Snippet: C57 mouse embryonic fibroblasts (MEF) were obtained from ATCC (SCRC-1008; Manassas, VA) and served as a wild-type MEF control.

Techniques: Infection, Staining, Labeling

Journal: Frontiers in Immunology

Article Title: The Progression of Cell Death Affects the Rejection of Allogeneic Tumors in Immune-Competent Mice – Implications for Cancer Therapy

doi: 10.3389/fimmu.2014.00560

Figure Lengend Snippet: Conditional expression of death inducing proteins . (A) Schematic overview of the constructs used to establish the regulatory system. The vector pWHE644 represents the regulator construct. A human EF1α promoter constitutively transcribes a tricistronic mRNA. This mRNA contains the reverse transactivator rtTA2 S -M2 (blue arrow), the transsilencer tTS D -PP (yellow arrow), and a selection marker (puromycin resistance; gray arrow). Translation of the latter two genes is mediated by internal ribosome entry sites (IRES; open boxes) from polio-virus (PV) and encephalomyocarditis- virus (EMCV). The vector pWHE655 contains the response unit used for stable transfections. It features the target gene (red arrow) driven by the Tet-responsive promoter TRE tight (open box, broken arrow) and flanked by two repeats each of a 250 bp sequence from the chicken HS4 insulator (blue triangles). A murine phosphoglycerate kinase 1 promoter (PGK; broken arrow) drives expression of a gene mediating G418-resistance. PolyA sites in all vectors are marked by a “ ⊥.” (B) Schematic representation of the cytotoxic test proteins. The residues that border the active domains expressed in the experiment are indicated above their respective closed box. A methionine added to allow translation is represented by a star. (C) Schematic overview of the regulatory system. In the OFF-State, a transsilencer (white) binds to the minimal promoter (open boxes, broken arrow) and actively suppresses transcription (cross). In the ON-State, doxycycline (blue circles) binds to both transsilencer and reverse transactivator (black). The former dissociates from, the latter binds to the minimal promoter and activates transcription (gray arrow). (D) Response of the regulatory system to different doxycycline concentrations. The B16F10-tBid transfected cell line was incubated for 24 h with various concentrations of doxycycline and mortality was measured, shown for one representative experiment out of three performed. Concentrations between 5 and 10 μg/ml showed the highest extent of cell death. An additional control at 10 μg/ml Doxy with the parental stably transfected cell line B16F10-644 was included to discard doxycycline toxicity at higher concentrations as cause of cell death (dark green diamond). Cell viability at time point “0” is shown as light green diamond.

Article Snippet: The C57BL/6 mouse-derived melanoma cell line B16F10 bearing the haplotype H2b was purchased from ATCC (#CRL-6475) and propagated in DMEM supplemented with 10% FBS and penicillin–streptomycin (D10) at 37°C in a 5% CO 2 atmosphere.

Techniques: Expressing, Construct, Plasmid Preparation, Selection, Marker, Virus, Transfection, Sequencing, Incubation, Control, Stable Transfection

Journal: Frontiers in Immunology

Article Title: The Progression of Cell Death Affects the Rejection of Allogeneic Tumors in Immune-Competent Mice – Implications for Cancer Therapy

doi: 10.3389/fimmu.2014.00560

Figure Lengend Snippet: Six parameter classification by flow cytometry of the cell death phenotype of dying and dead B16F10 cells . Cell death analysis is based on morphological features (FSc and SSc), on the exposure of PS (annexin A5-FITC) and plasma membrane ion selectivity (PI), on the mitochondrial membrane potential [DiIC1(5)] and on nuclear DNA content (Hoechst 33342) detected by flow cytometry. Note: after proper gating, up to eight physiologically different subpopulations can be recorded. Dot plots exemplarily show B16F10-revCasp-3 cells after 18 h of doxycycline (5 μg/ml) treatment (A) . Rapid cell death occurred after 6 h in tBid-expressing cells and more than 95% cell death was observed after 24 h. In the presence of various caspase inhibitors [z-VAD-fmk, z-DEVD-fmk (caspase-3 inhibitor) and Ac-LEHD-cmk (caspase-9 inhibitor); all 50 μM], a significant increase in the stressed cell fraction displaying low-mitochondrial potential was observed (B) . Expression of revCasp-3 in B16F10 cells induced cell death after 24 h in more than 80% of the cells. z-VAD-fmk (50 μM) completely inhibited doxycycline-driven apoptosis. Note: stressed cells do not arise in this type of cell death induction (C) . Expression of CpnT CTD induced cell death in more than 90% of the cells after 18 h. Note: primary necrosis was the most common type of cell death observed and death occurred independently of caspase activity (50 μM z-VAD-fmk) (D) . Lethal UVB irradiation (240 mJ/cm 2 ) of parental B16F10 cells causes a rather slow progressing kind of cell death. Note: in the presence of z-VAD-fmk (50 μM), a significant increase of the stressed cell fraction displaying low-mitochondrial potential was observed (E) . Heat shock (56°C, 30 min) caused immediate necrosis in 100% of cells independent of caspase activity (F) . Displayed are the mean values from three independent experiments of relative percentages of each cell phenotype during 48 h of culture (B–F) .

Article Snippet: The C57BL/6 mouse-derived melanoma cell line B16F10 bearing the haplotype H2b was purchased from ATCC (#CRL-6475) and propagated in DMEM supplemented with 10% FBS and penicillin–streptomycin (D10) at 37°C in a 5% CO 2 atmosphere.

Techniques: Flow Cytometry, Clinical Proteomics, Membrane, Expressing, Activity Assay, Irradiation

Journal: Frontiers in Immunology

Article Title: The Progression of Cell Death Affects the Rejection of Allogeneic Tumors in Immune-Competent Mice – Implications for Cancer Therapy

doi: 10.3389/fimmu.2014.00560

Figure Lengend Snippet: Reactive oxygen species (ROS) production by dying B16F10 melanoma cells . Cells were induced to die by conditional expression of the death proteins tBid, revCasp-3, and CpnT CTD or by UVB irradiation, stained with the ROS sensor DCFH and with PI and analyzed by flow cytometry (A) . Inhibition of ROS production was performed by treatment with N -acetyl-cysteine (NAC) or mitoTEMPO, 100 μM, respectively, and recorded at 9 h after death induction (B) . Mean and SEM values of the mean fluorescence intensities of FL1 in viable cells (PI-negative) are displayed for different time points. At least three independent experiments were performed (Two and one stars indicate statistical significance at the p < 0.001 and p < 0.05 levels, respectively).

Article Snippet: The C57BL/6 mouse-derived melanoma cell line B16F10 bearing the haplotype H2b was purchased from ATCC (#CRL-6475) and propagated in DMEM supplemented with 10% FBS and penicillin–streptomycin (D10) at 37°C in a 5% CO 2 atmosphere.

Techniques: Expressing, Irradiation, Staining, Flow Cytometry, Inhibition, Fluorescence

Journal: Frontiers in Immunology

Article Title: The Progression of Cell Death Affects the Rejection of Allogeneic Tumors in Immune-Competent Mice – Implications for Cancer Therapy

doi: 10.3389/fimmu.2014.00560

Figure Lengend Snippet: Growth of B16F10 melanoma cells in the allogeneic host and concomitant immunity . Four million viable B16F10 cells (VC) were implanted s.c. in the right flank of BALB/c mice. Mice developed tumors reaching their maximum size after 2–3 weeks, followed by rejection [ (A) , black line]. Mice implanted with 4 million UVB-irradiated cells did not develop primary tumors [ (A) , purple line]. After challenge with 2 million viable cells s.c. on the left flank, those mice bearing primary tumors did not develop secondary tumors [ (B) , black line], while mice primarily inoculated with irradiated cells developed tumors similar to those of the naïve group [ (B) , purple and green lines, respectively]. Mean values ( n = 8) and the SEM are displayed. Time points showing statistical significance when compared to the group of mice implanted with VC are highlighted. Two stars and one star indicate statistical significance at the p < 0.01 and p < 0.05 levels, respectively. The two way ANOVA test corrected by Bonferroni was applied in this experiment.

Article Snippet: The C57BL/6 mouse-derived melanoma cell line B16F10 bearing the haplotype H2b was purchased from ATCC (#CRL-6475) and propagated in DMEM supplemented with 10% FBS and penicillin–streptomycin (D10) at 37°C in a 5% CO 2 atmosphere.

Techniques: Irradiation

Journal: Frontiers in Immunology

Article Title: The Progression of Cell Death Affects the Rejection of Allogeneic Tumors in Immune-Competent Mice – Implications for Cancer Therapy

doi: 10.3389/fimmu.2014.00560

Figure Lengend Snippet: Immune response against dead or dying allogeneic tumor cells . BALB/c mice ( n = 5) were immunized in the right flank s.c. (single dose) with B16F10 dying/dead cells. After 10 days, mice were challenged s.c. in the left flank with 2 million viable cells of the parental cell line B16F10-644. Tumor growth was monitored for 30 further days (A) . Cell death was induced by UVB irradiation; heat shock; doxycycline-controlled expression of death proteins tBid, revCasp-3, and CpnT CTD . Displayed are the mean values ( n = 5) of relative tumor volumes and SEM [ (B) , * p < 0.05 after Mann–Whitney U test] and the integral of tumor size [ (C) , total tumor mass]. Inverse association between ROS production and total tumor mass developed in the allogeneic host (D) .

Article Snippet: The C57BL/6 mouse-derived melanoma cell line B16F10 bearing the haplotype H2b was purchased from ATCC (#CRL-6475) and propagated in DMEM supplemented with 10% FBS and penicillin–streptomycin (D10) at 37°C in a 5% CO 2 atmosphere.

Techniques: Irradiation, Expressing, MANN-WHITNEY