90
|
Sangon Biotech
fret oligonucleotides c-kit1 Fret Oligonucleotides C Kit1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fret oligonucleotides c-kit1/product/Sangon Biotech Average 90 stars, based on 1 article reviews
fret oligonucleotides c-kit1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
PeproTech
5 ng/ml gm-csf (c-kit1 cells) 5 Ng/Ml Gm Csf (C Kit1 Cells), supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 ng/ml gm-csf (c-kit1 cells)/product/PeproTech Average 90 stars, based on 1 article reviews
5 ng/ml gm-csf (c-kit1 cells) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Kaneka Corp
c-kit1 (5ʹ′-famggg agg gcg ctg gga gga ggg-tamra-3ʹ′ C Kit1 (5ʹ′ Famggg Agg Gcg Ctg Gga Gga Ggg Tamra 3ʹ′, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 (5ʹ′-famggg agg gcg ctg gga gga ggg-tamra-3ʹ′/product/Kaneka Corp Average 90 stars, based on 1 article reviews
c-kit1 (5ʹ′-famggg agg gcg ctg gga gga ggg-tamra-3ʹ′ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Tech Dragon
c-kit1 C Kit1, supplied by Tech Dragon, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1/product/Tech Dragon Average 90 stars, based on 1 article reviews
c-kit1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Alphamed INC
c-kit1 cells C Kit1 Cells, supplied by Alphamed INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 cells/product/Alphamed INC Average 90 stars, based on 1 article reviews
c-kit1 cells - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
StemCells Inc
c-kit1 cells C Kit1 Cells, supplied by StemCells Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 cells/product/StemCells Inc Average 90 stars, based on 1 article reviews
c-kit1 cells - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
biomers.net gmbh
fam-[d(agggagggcgctgggaggaggg)]-tamra sequence ( f-c-kit1-t Fam [D(Agggagggcgctgggaggaggg)] Tamra Sequence ( F C Kit1 T, supplied by biomers.net gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fam-[d(agggagggcgctgggaggaggg)]-tamra sequence ( f-c-kit1-t/product/biomers.net gmbh Average 90 stars, based on 1 article reviews
fam-[d(agggagggcgctgggaggaggg)]-tamra sequence ( f-c-kit1-t - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Oligos Etc
g4-dna c-kit1 G4 Dna C Kit1, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g4-dna c-kit1/product/Oligos Etc Average 90 stars, based on 1 article reviews
g4-dna c-kit1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |