91
|
Addgene inc
v 702 V 702, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/v 702/product/Addgene inc Average 91 stars, based on 1 article reviews
v 702 - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
90
|
JSR Corporation
cis-1,4-polybutadiene bro1 Cis 1,4 Polybutadiene Bro1, supplied by JSR Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cis-1,4-polybutadiene bro1/product/JSR Corporation Average 90 stars, based on 1 article reviews
cis-1,4-polybutadiene bro1 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
InterPro Inc
bro1 domain Bro1 Domain, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bro1 domain/product/InterPro Inc Average 90 stars, based on 1 article reviews
bro1 domain - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Verlag GmbH
bro 1 2 134 0 Bro 1 2 134 0, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bro 1 2 134 0/product/Verlag GmbH Average 90 stars, based on 1 article reviews
bro 1 2 134 0 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Azenta
alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’ Alix Mutants Oligonucleotide: Fl/Bro1 Sense 5’ Ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg 3’, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’/product/Azenta Average 90 stars, based on 1 article reviews
alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
N/A
|
Standard format: Plasmid sent in bacteria as agar stab
|
Buy from Supplier |
N/A
|
Standard format: Plasmid sent in bacteria as agar stab
|
Buy from Supplier |