bro1 Search Results


91
Addgene inc v 702
V 702, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v 702/product/Addgene inc
Average 91 stars, based on 1 article reviews
v 702 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

90
JSR Corporation cis-1,4-polybutadiene bro1
Cis 1,4 Polybutadiene Bro1, supplied by JSR Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cis-1,4-polybutadiene bro1/product/JSR Corporation
Average 90 stars, based on 1 article reviews
cis-1,4-polybutadiene bro1 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
InterPro Inc bro1 domain
Bro1 Domain, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bro1 domain/product/InterPro Inc
Average 90 stars, based on 1 article reviews
bro1 domain - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Verlag GmbH bro 1 2 134 0
Bro 1 2 134 0, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bro 1 2 134 0/product/Verlag GmbH
Average 90 stars, based on 1 article reviews
bro 1 2 134 0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Azenta alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’
Alix Mutants Oligonucleotide: Fl/Bro1 Sense 5’ Ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg 3’, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’/product/Azenta
Average 90 stars, based on 1 article reviews
alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier

N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier

Image Search Results