biotin-ub Search Results


N/A
Recognizes the ribosomal RNA gene promoter and activates transcription mediated by RNA polymerase I through cooperative interactions with the transcription factor SL1/TIF-IB complex. It binds specifically to the upstream control element.
  Buy from Supplier

90
TriLink biotinylated target dna oligonucleotide 5'/tgctggtttccgttgtttgt/biotinbb-/3
Biotinylated Target Dna Oligonucleotide 5'/Tgctggtttccgttgtttgt/Biotinbb /3, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/biotin+conjugated+rna+oligonucleotides/pmc04104391-140-0-11
Average 90 stars, based on 1 article reviews
biotinylated target dna oligonucleotide 5'/tgctggtttccgttgtttgt/biotinbb-/3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

95
Chem Impex International d biotin
D Biotin, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/D-Biotin/pm35952650__cb2c00527_si_001-41-115-116
Average 95 stars, based on 1 article reviews
d biotin - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

90
Enzo Biochem biotin-ub
Biotin Ub, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/biotinylated+ubiquitin/10__1158_slash_1541___7786__mcr___17___0364-119-14-15
Average 90 stars, based on 1 article reviews
biotin-ub - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

92
R&D Systems biotin ub
Biotin Ub, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/Recombinant+Human+Ubiquitin+N-Terminal+Biotin+Protein%2C+CF/pmc04894550-372-40-41
Average 92 stars, based on 1 article reviews
biotin ub - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

90
TriLink target dna oligonucleotide (59/tgctggtttccgttgtttgt/ biotinbb-/39, 50 nmol/ml)
Target Dna Oligonucleotide (59/Tgctggtttccgttgtttgt/ Biotinbb /39, 50 Nmol/Ml), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/target+dna+oligonucleotide++59+tgctggtttccgttgtttgt++biotinbb++39++50+nmol+ml+/pm25043673-170-0-12
Average 90 stars, based on 1 article reviews
target dna oligonucleotide (59/tgctggtttccgttgtttgt/ biotinbb-/39, 50 nmol/ml) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Dyomics Inc dyomics 634 (dy634
Multi-color sSMLM imaging of COS-7 cells, (a) SC distribution of AF647, CF660C and <t>CF680;</t> (b) Identification fraction of the three dyes in the preset channels; (c) SMLM imaging of a COS-7 cell which the ATPB, Tubulin and TOM20 proteins were labeled with AF647, CF660C and CF680 respectively; (d-f) pseudo color-coded images of the same sample in (c) classified in three spectral windows based on their spectral signature and the sSMLM image (g).
Dyomics 634 (Dy634, supplied by Dyomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/dy+634/pmc06620783-51-11-16
Average 90 stars, based on 1 article reviews
dyomics 634 (dy634 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

97
Azure Biosystems agarose gel with gelred
Multi-color sSMLM imaging of COS-7 cells, (a) SC distribution of AF647, CF660C and <t>CF680;</t> (b) Identification fraction of the three dyes in the preset channels; (c) SMLM imaging of a COS-7 cell which the ATPB, Tubulin and TOM20 proteins were labeled with AF647, CF660C and CF680 respectively; (d-f) pseudo color-coded images of the same sample in (c) classified in three spectral windows based on their spectral signature and the sSMLM image (g).
Agarose Gel With Gelred, supplied by Azure Biosystems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/Azure+600/pmc11119423-65-6-26
Average 97 stars, based on 1 article reviews
agarose gel with gelred - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier

96
Vector Laboratories avidin biotin blocking kit
Multi-color sSMLM imaging of COS-7 cells, (a) SC distribution of AF647, CF660C and <t>CF680;</t> (b) Identification fraction of the three dyes in the preset channels; (c) SMLM imaging of a COS-7 cell which the ATPB, Tubulin and TOM20 proteins were labeled with AF647, CF660C and CF680 respectively; (d-f) pseudo color-coded images of the same sample in (c) classified in three spectral windows based on their spectral signature and the sSMLM image (g).
Avidin Biotin Blocking Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/biotin-ub/Avidin%2FBiotin+Blocking+Kit/pm15095882-32-31-36
Average 96 stars, based on 1 article reviews
avidin biotin blocking kit - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

N/A
The U-box domain is a modified RING finger motif that has been implicated in the ubiquitin/proteasome system. The ubiquitin-conjugating enzyme 7-interacting protein 5 (UIP5), also designated U-box domain-containing protein 5 or RING finger protein 37,
  Buy from Supplier

N/A
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s,
  Buy from Supplier


Image Search Results


Multi-color sSMLM imaging of COS-7 cells, (a) SC distribution of AF647, CF660C and CF680; (b) Identification fraction of the three dyes in the preset channels; (c) SMLM imaging of a COS-7 cell which the ATPB, Tubulin and TOM20 proteins were labeled with AF647, CF660C and CF680 respectively; (d-f) pseudo color-coded images of the same sample in (c) classified in three spectral windows based on their spectral signature and the sSMLM image (g).

Journal: Applied optics

Article Title: Multi-color super-resolution imaging using spectroscopic single-molecule localization microscopy with optimal spectral dispersion

doi: 10.1364/AO.58.002248

Figure Lengend Snippet: Multi-color sSMLM imaging of COS-7 cells, (a) SC distribution of AF647, CF660C and CF680; (b) Identification fraction of the three dyes in the preset channels; (c) SMLM imaging of a COS-7 cell which the ATPB, Tubulin and TOM20 proteins were labeled with AF647, CF660C and CF680 respectively; (d-f) pseudo color-coded images of the same sample in (c) classified in three spectral windows based on their spectral signature and the sSMLM image (g).

Article Snippet: Sample preparation NHS-ester functionalized Alexa Fluor 647 (AF647, Thermofisher), CF660C and CF680 (Biotinum), Dyomics 634 (Dy634, Dyomics Inc.), Cy®5.5 (Sigma) were stored at −20 °C.

Techniques: Imaging, Labeling

Single-molecule fluorescence emission signature of dye-protein conjugates.

Journal: Applied optics

Article Title: Multi-color super-resolution imaging using spectroscopic single-molecule localization microscopy with optimal spectral dispersion

doi: 10.1364/AO.58.002248

Figure Lengend Snippet: Single-molecule fluorescence emission signature of dye-protein conjugates.

Article Snippet: Sample preparation NHS-ester functionalized Alexa Fluor 647 (AF647, Thermofisher), CF660C and CF680 (Biotinum), Dyomics 634 (Dy634, Dyomics Inc.), Cy®5.5 (Sigma) were stored at −20 °C.

Techniques: Fluorescence