bglii Search Results


97
New England Biolabs bgl ii
Bgl Ii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/BglII/pmc07721343-1132-40-77
Average 97 stars, based on 1 article reviews
bgl ii - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

91
Jena Bioscience dddyrk1afor atggatagatctgcaaaatcaagaaatgatgcacc bglii dddyrk1arev gttgttaagcttattgctttttttttgctttggcagtg
Dddyrk1afor Atggatagatctgcaaaatcaagaaatgatgcacc Bglii Dddyrk1arev Gttgttaagcttattgctttttttttgctttggcagtg, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/BglII/pmc04910162__srep28241___s1-26-53-89
Average 91 stars, based on 1 article reviews
dddyrk1afor atggatagatctgcaaaatcaagaaatgatgcacc bglii dddyrk1arev gttgttaagcttattgctttttttttgctttggcagtg - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

99
Beyotime restriction sites
Restriction Sites, supplied by Beyotime, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/BglII/pm40076781-351-13-34
Average 99 stars, based on 1 article reviews
restriction sites - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
Addgene inc 136546 anxa2
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
136546 Anxa2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/NdeI+-+SpeI(NheI)+-+BamHI%2FBglII+-+ANXA2+(23-339)+(Plasmid+%23136546)/pm32442400-188-19-29
Average 90 stars, based on 1 article reviews
136546 anxa2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Addgene inc paper addgene id
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Paper Addgene Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/NdeI+-+SpeI(NheI)+-+BamHI%2FBglII+-+ANXA2+(29-339)+(Plasmid+%23136544)/pm32442400-188-28-29
Average 90 stars, based on 1 article reviews
paper addgene id - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

97
New England Biolabs restriction enzymes bglii
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Restriction Enzymes Bglii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/BglII/pm37392922-104-21-26
Average 97 stars, based on 1 article reviews
restriction enzymes bglii - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

90
Promega bglii
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/bglii/10__1074_slash_jbc__m111224200-50-15-30
Average 90 stars, based on 1 article reviews
bglii - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega restriction enzyme bglii
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Restriction Enzyme Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/restriction+enzyme+bglii/pm19329137-113-10-22
Average 90 stars, based on 1 article reviews
restriction enzyme bglii - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega 1324 bp bglii and hindiii fragment of the human hspa7 promoter re-cloned from p2500-cat vector
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
1324 Bp Bglii And Hindiii Fragment Of The Human Hspa7 Promoter Re Cloned From P2500 Cat Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/1324+bp+BglII+and+HindIII+fragment+of+the+human+HSPA7+promoter+re+cloned+from+p2500+CAT+vector/pmc07308270-94-19-29
Average 90 stars, based on 1 article reviews
1324 bp bglii and hindiii fragment of the human hspa7 promoter re-cloned from p2500-cat vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Carl Roth GmbH bglii
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Bglii, supplied by Carl Roth GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/bglii/pm21447051-241-7-23
Average 90 stars, based on 1 article reviews
bglii - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega restriction enzymes spei and bglii
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Restriction Enzymes Spei And Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/restriction+enzymes+spei+and+bglii/us09441248-316-22-25
Average 90 stars, based on 1 article reviews
restriction enzymes spei and bglii - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega saci and bglii
Figure 2. Schematic Representation of the <t>ANXA2</t> Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Saci And Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii/saci+and+bglii/pmc03302474-49-28-8
Average 90 stars, based on 1 article reviews
saci and bglii - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Figure 2. Schematic Representation of the ANXA2 Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.

Journal: Structure (London, England : 1993)

Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.

doi: 10.1016/j.str.2020.05.001

Figure Lengend Snippet: Figure 2. Schematic Representation of the ANXA2 Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and 136546 ANXA2 29-339 in modified pET15b vector (pANXA229-339) This paper Addgene ID: 136544 and 136545 wtMBP in in pET-MBP This paper N/A P53 TAD17-56 – scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A PDZ – ANXA223-339 in modified pET15b vector (pANXA223-339) Gogl et al., 2018 N/A wtMBP – scS100A4D8 in pET-MBP This paper N/A wtMPB – PDZ in pET-MBP Gogl et al., 2018 N/A PDZ in pET-MBP Gogl et al., 2018 N/A scS100A4D8 in modified pET15b vector (pEV) This paper N/A S100A4 in modified pET15b vector (pEV) Kiss et al., 2012 N/A P53 TAD1-60 in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide mutants in modified pGEX vector (pETARA) This paper N/A Tobacco etch virus (TEV) protease in pTH24 vector van den Berg et al., 2006 N/A Software and Algorithms Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/ Phenix Adams et al., 2010 https://www.phenix-online.org Pymol PYMOL http://www.pymol.org Phaser McCoy, 2007 http://www-structmed.cimr.cam.ac.uk/ phaser_obsolete/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Origin for ITC 5.0 OriginLab http://www.originlab.com/ Origin 8 OriginLab http://www.originlab.com/ GeneTools GeneTools http://www.syngene.com/genetools-software- download Bestsel Micsonai et al., 2015 http://bestsel.elte.hu/ Other Phenyl Sepharose 6 Fast Flow GE Healthcare #17-0973-05 HiTrap SP HP cation exchange column GE Healthcare #17115101 Jupiter 300 C5 column Phenomenex #00G-4052-E0 384-well microplates Corning #3676 Profinity IMAC resin Bio-Rad #1560131 Protino Glutathione Agarose 4B resin Macherey-Nagel #745500.10 Amylose resin NEB #E8021S HighTrap Heparin HP column GE Healthcare (Sigma) #GE17-0406-01 HiTrap Desalting column GE Healthcare (Sigma) #GE29-0486-84

Techniques: Construct

Figure 4. Crystal Screening of Different wtMBP and ANXA2 Constructs (A and B) (A) ANXA229339 and (B) PDZ-ANXA223339 crystals were formed under numerous JCSG+ (blue) and Morpheus (red) crystallization conditions at 250 mM concentration. (C–F) (C) In the case of the larger scS100A4D8-ANXA229339 construct, crystal formation significantly dropped. Crystal formation of (D) wtMBP, (E) wtMBP-PDZ, and (F) wtMBP-scS100A4D8 at 2 mM concentration is also presented. Crystal growth was monitored for a month.

Journal: Structure (London, England : 1993)

Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.

doi: 10.1016/j.str.2020.05.001

Figure Lengend Snippet: Figure 4. Crystal Screening of Different wtMBP and ANXA2 Constructs (A and B) (A) ANXA229339 and (B) PDZ-ANXA223339 crystals were formed under numerous JCSG+ (blue) and Morpheus (red) crystallization conditions at 250 mM concentration. (C–F) (C) In the case of the larger scS100A4D8-ANXA229339 construct, crystal formation significantly dropped. Crystal formation of (D) wtMBP, (E) wtMBP-PDZ, and (F) wtMBP-scS100A4D8 at 2 mM concentration is also presented. Crystal growth was monitored for a month.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and 136546 ANXA2 29-339 in modified pET15b vector (pANXA229-339) This paper Addgene ID: 136544 and 136545 wtMBP in in pET-MBP This paper N/A P53 TAD17-56 – scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A PDZ – ANXA223-339 in modified pET15b vector (pANXA223-339) Gogl et al., 2018 N/A wtMBP – scS100A4D8 in pET-MBP This paper N/A wtMPB – PDZ in pET-MBP Gogl et al., 2018 N/A PDZ in pET-MBP Gogl et al., 2018 N/A scS100A4D8 in modified pET15b vector (pEV) This paper N/A S100A4 in modified pET15b vector (pEV) Kiss et al., 2012 N/A P53 TAD1-60 in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide mutants in modified pGEX vector (pETARA) This paper N/A Tobacco etch virus (TEV) protease in pTH24 vector van den Berg et al., 2006 N/A Software and Algorithms Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/ Phenix Adams et al., 2010 https://www.phenix-online.org Pymol PYMOL http://www.pymol.org Phaser McCoy, 2007 http://www-structmed.cimr.cam.ac.uk/ phaser_obsolete/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Origin for ITC 5.0 OriginLab http://www.originlab.com/ Origin 8 OriginLab http://www.originlab.com/ GeneTools GeneTools http://www.syngene.com/genetools-software- download Bestsel Micsonai et al., 2015 http://bestsel.elte.hu/ Other Phenyl Sepharose 6 Fast Flow GE Healthcare #17-0973-05 HiTrap SP HP cation exchange column GE Healthcare #17115101 Jupiter 300 C5 column Phenomenex #00G-4052-E0 384-well microplates Corning #3676 Profinity IMAC resin Bio-Rad #1560131 Protino Glutathione Agarose 4B resin Macherey-Nagel #745500.10 Amylose resin NEB #E8021S HighTrap Heparin HP column GE Healthcare (Sigma) #GE17-0406-01 HiTrap Desalting column GE Healthcare (Sigma) #GE29-0486-84

Techniques: Construct, Crystallization Assay, Concentration Assay

Figure 5. Crystallization of ANXA2 Constructs and wtMBP at Different Concentrations Using the Best Conditions Found in the Screening Experiments Formation of (A) ANXA229339 (black), PDZ-ANXA223339 (gray), and scS100A4D8-ANXA229339 (horizontal lines) crystals were monitored at different protein concentrations for a month. (B) MBP crystals (vertical lines) formed only at higher than 500 mM concentration (~20.5 mg/mL). No MBP fused constructs were tested since no hit was found during screening. (C–E) (C) PDZ-ANXA223339, (D) ANXA229339, and (E) wtMBP crystals when samples were used at 250 mM (2 mM), 62.5 mM (1 mM), and 7 mM concentrations (0.5 mM) from left to right (wtMBP concentrations are in parenthesis). Small crystals are highlighted in white boxes. White bars represent 0.5 mm.

Journal: Structure (London, England : 1993)

Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.

doi: 10.1016/j.str.2020.05.001

Figure Lengend Snippet: Figure 5. Crystallization of ANXA2 Constructs and wtMBP at Different Concentrations Using the Best Conditions Found in the Screening Experiments Formation of (A) ANXA229339 (black), PDZ-ANXA223339 (gray), and scS100A4D8-ANXA229339 (horizontal lines) crystals were monitored at different protein concentrations for a month. (B) MBP crystals (vertical lines) formed only at higher than 500 mM concentration (~20.5 mg/mL). No MBP fused constructs were tested since no hit was found during screening. (C–E) (C) PDZ-ANXA223339, (D) ANXA229339, and (E) wtMBP crystals when samples were used at 250 mM (2 mM), 62.5 mM (1 mM), and 7 mM concentrations (0.5 mM) from left to right (wtMBP concentrations are in parenthesis). Small crystals are highlighted in white boxes. White bars represent 0.5 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and 136546 ANXA2 29-339 in modified pET15b vector (pANXA229-339) This paper Addgene ID: 136544 and 136545 wtMBP in in pET-MBP This paper N/A P53 TAD17-56 – scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A PDZ – ANXA223-339 in modified pET15b vector (pANXA223-339) Gogl et al., 2018 N/A wtMBP – scS100A4D8 in pET-MBP This paper N/A wtMPB – PDZ in pET-MBP Gogl et al., 2018 N/A PDZ in pET-MBP Gogl et al., 2018 N/A scS100A4D8 in modified pET15b vector (pEV) This paper N/A S100A4 in modified pET15b vector (pEV) Kiss et al., 2012 N/A P53 TAD1-60 in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide mutants in modified pGEX vector (pETARA) This paper N/A Tobacco etch virus (TEV) protease in pTH24 vector van den Berg et al., 2006 N/A Software and Algorithms Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/ Phenix Adams et al., 2010 https://www.phenix-online.org Pymol PYMOL http://www.pymol.org Phaser McCoy, 2007 http://www-structmed.cimr.cam.ac.uk/ phaser_obsolete/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Origin for ITC 5.0 OriginLab http://www.originlab.com/ Origin 8 OriginLab http://www.originlab.com/ GeneTools GeneTools http://www.syngene.com/genetools-software- download Bestsel Micsonai et al., 2015 http://bestsel.elte.hu/ Other Phenyl Sepharose 6 Fast Flow GE Healthcare #17-0973-05 HiTrap SP HP cation exchange column GE Healthcare #17115101 Jupiter 300 C5 column Phenomenex #00G-4052-E0 384-well microplates Corning #3676 Profinity IMAC resin Bio-Rad #1560131 Protino Glutathione Agarose 4B resin Macherey-Nagel #745500.10 Amylose resin NEB #E8021S HighTrap Heparin HP column GE Healthcare (Sigma) #GE17-0406-01 HiTrap Desalting column GE Healthcare (Sigma) #GE29-0486-84

Techniques: Crystallization Assay, Construct, Concentration Assay

Figure 6. Crystal Packing of ANXA2 in Structures Found in the PDB (A–C) (A) ANXA2 in Ca2+-bound form (PDB: 1XJL, light and dark gray) (Rosengarth and Luecke, 2004) produces elongated crystal lattices (same in PDB: 5LPX, 5LQ0, 2HYW, 4X9P, and 5LQ2 structures) (Ecse´ di et al., 2017; Shao et al., 2006; Raddum et al., 2015). Structures of previously solved (B) PDZ-ANXA223339

Journal: Structure (London, England : 1993)

Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.

doi: 10.1016/j.str.2020.05.001

Figure Lengend Snippet: Figure 6. Crystal Packing of ANXA2 in Structures Found in the PDB (A–C) (A) ANXA2 in Ca2+-bound form (PDB: 1XJL, light and dark gray) (Rosengarth and Luecke, 2004) produces elongated crystal lattices (same in PDB: 5LPX, 5LQ0, 2HYW, 4X9P, and 5LQ2 structures) (Ecse´ di et al., 2017; Shao et al., 2006; Raddum et al., 2015). Structures of previously solved (B) PDZ-ANXA223339

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and 136546 ANXA2 29-339 in modified pET15b vector (pANXA229-339) This paper Addgene ID: 136544 and 136545 wtMBP in in pET-MBP This paper N/A P53 TAD17-56 – scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A PDZ – ANXA223-339 in modified pET15b vector (pANXA223-339) Gogl et al., 2018 N/A wtMBP – scS100A4D8 in pET-MBP This paper N/A wtMPB – PDZ in pET-MBP Gogl et al., 2018 N/A PDZ in pET-MBP Gogl et al., 2018 N/A scS100A4D8 in modified pET15b vector (pEV) This paper N/A S100A4 in modified pET15b vector (pEV) Kiss et al., 2012 N/A P53 TAD1-60 in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide mutants in modified pGEX vector (pETARA) This paper N/A Tobacco etch virus (TEV) protease in pTH24 vector van den Berg et al., 2006 N/A Software and Algorithms Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/ Phenix Adams et al., 2010 https://www.phenix-online.org Pymol PYMOL http://www.pymol.org Phaser McCoy, 2007 http://www-structmed.cimr.cam.ac.uk/ phaser_obsolete/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Origin for ITC 5.0 OriginLab http://www.originlab.com/ Origin 8 OriginLab http://www.originlab.com/ GeneTools GeneTools http://www.syngene.com/genetools-software- download Bestsel Micsonai et al., 2015 http://bestsel.elte.hu/ Other Phenyl Sepharose 6 Fast Flow GE Healthcare #17-0973-05 HiTrap SP HP cation exchange column GE Healthcare #17115101 Jupiter 300 C5 column Phenomenex #00G-4052-E0 384-well microplates Corning #3676 Profinity IMAC resin Bio-Rad #1560131 Protino Glutathione Agarose 4B resin Macherey-Nagel #745500.10 Amylose resin NEB #E8021S HighTrap Heparin HP column GE Healthcare (Sigma) #GE17-0406-01 HiTrap Desalting column GE Healthcare (Sigma) #GE29-0486-84

Techniques:

Figure 7. Crystal Contacts of Two ANXA2 Molecules (A) The aligned ANXA2 structures (PDB: 5LPX, 5LQ0, 5LPU, 1XJL, 2HYW, 4X9P, and 5LQ2) (Ecse´ di et al., 2017; Rosengarth and Luecke, 2004; Raddum et al., 2015; Shao et al., 2006) show the conservative crystal contacts. The additional segments of the crystal lattice (light gray ANXA2s are in identical position) defines the solution channel (green ellipse) formed in ANXA2 crystals. (B) S234 of light gray (molecule B) ANXA2 helps the coordination of Ca2+ (brown sphere) connecting to dark gray ANXA2 (molecule A). (C and D) (C) Besides Ca2+ coordination, residues of the nearby a helices form ionic, while (D) two tyrosines form hydrophobic interactions, further stabilizing the assembly. Residues of molecule B are underlined.

Journal: Structure (London, England : 1993)

Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.

doi: 10.1016/j.str.2020.05.001

Figure Lengend Snippet: Figure 7. Crystal Contacts of Two ANXA2 Molecules (A) The aligned ANXA2 structures (PDB: 5LPX, 5LQ0, 5LPU, 1XJL, 2HYW, 4X9P, and 5LQ2) (Ecse´ di et al., 2017; Rosengarth and Luecke, 2004; Raddum et al., 2015; Shao et al., 2006) show the conservative crystal contacts. The additional segments of the crystal lattice (light gray ANXA2s are in identical position) defines the solution channel (green ellipse) formed in ANXA2 crystals. (B) S234 of light gray (molecule B) ANXA2 helps the coordination of Ca2+ (brown sphere) connecting to dark gray ANXA2 (molecule A). (C and D) (C) Besides Ca2+ coordination, residues of the nearby a helices form ionic, while (D) two tyrosines form hydrophobic interactions, further stabilizing the assembly. Residues of molecule B are underlined.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and 136546 ANXA2 29-339 in modified pET15b vector (pANXA229-339) This paper Addgene ID: 136544 and 136545 wtMBP in in pET-MBP This paper N/A P53 TAD17-56 – scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A scS100A4D8 – ANXA229-339 in modified pET15b vector (pANXA229-339) This paper N/A PDZ – ANXA223-339 in modified pET15b vector (pANXA223-339) Gogl et al., 2018 N/A wtMBP – scS100A4D8 in pET-MBP This paper N/A wtMPB – PDZ in pET-MBP Gogl et al., 2018 N/A PDZ in pET-MBP Gogl et al., 2018 N/A scS100A4D8 in modified pET15b vector (pEV) This paper N/A S100A4 in modified pET15b vector (pEV) Kiss et al., 2012 N/A P53 TAD1-60 in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide in modified pGEX vector (pETARA) This paper N/A P53 TAD17-56 peptide mutants in modified pGEX vector (pETARA) This paper N/A Tobacco etch virus (TEV) protease in pTH24 vector van den Berg et al., 2006 N/A Software and Algorithms Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/ Phenix Adams et al., 2010 https://www.phenix-online.org Pymol PYMOL http://www.pymol.org Phaser McCoy, 2007 http://www-structmed.cimr.cam.ac.uk/ phaser_obsolete/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Origin for ITC 5.0 OriginLab http://www.originlab.com/ Origin 8 OriginLab http://www.originlab.com/ GeneTools GeneTools http://www.syngene.com/genetools-software- download Bestsel Micsonai et al., 2015 http://bestsel.elte.hu/ Other Phenyl Sepharose 6 Fast Flow GE Healthcare #17-0973-05 HiTrap SP HP cation exchange column GE Healthcare #17115101 Jupiter 300 C5 column Phenomenex #00G-4052-E0 384-well microplates Corning #3676 Profinity IMAC resin Bio-Rad #1560131 Protino Glutathione Agarose 4B resin Macherey-Nagel #745500.10 Amylose resin NEB #E8021S HighTrap Heparin HP column GE Healthcare (Sigma) #GE17-0406-01 HiTrap Desalting column GE Healthcare (Sigma) #GE29-0486-84

Techniques: