asic2a Search Results


93
Alomone Labs asic2a subunit
ASIC1 and <t>ASIC2a</t> are located at the mouse NMJ. A. All of the images shown are maximum projections of 16 images collected at 0.5 μm increments vertically through the field containing the NMJ. α-bungarotoxin (α -BTX) is shown in Red. ASIC2a antibodies are in Green. Arrows point to clusters of ASIC2a staining that are outside the area defining the motor nerve terminal but near perisynaptic Schwann cell nuclei, indicated by the DAPI stain (Blue). Calibration bar, 10 μm. B. All of the images shown are maximum projections of 18 images collected at 0.5 μm increments vertically through the field containing the NMJ. α-bungarotoxin (α -BTX) is shown in Red. ASIC1 antibodies are in Green. Arrows point to clusters of ASIC2a staining that are outside the area defining the motor nerve terminal but near perisynaptic Schwann cell nuclei, indicated by the DAPI stain (Blue). Calibration bar, 10 μm.
Asic2a Subunit, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/asic2a subunit/product/Alomone Labs
Average 93 stars, based on 1 article reviews
asic2a subunit - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech rabbit polyclonal asic2 antibody
( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total <t>ASIC2</t> expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.
Rabbit Polyclonal Asic2 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal asic2 antibody/product/Proteintech
Average 93 stars, based on 1 article reviews
rabbit polyclonal asic2 antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Alomone Labs asic2a
( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total <t>ASIC2</t> expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.
Asic2a, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/asic2a/product/Alomone Labs
Average 90 stars, based on 1 article reviews
asic2a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation protein sequence of rat asic2a
( a ) Principle of the two-component optogenetic (TCO) approach. Upon illumination the light-activated proton pump may moderately acidify the local extracellular medium and activate acid-sensitive ion channels, ASICs, via their proton-sensing domain. This results in a remote but large sodium influx that can be used for sustained cell depolarization at moderate light intensities. In Xenopus oocytes, a light-driven proton pump of Coccomyxa subellipsoidea (CsR) was used. ( b–d ) Macroscopic currents of CsR T46N coexpressed with rat ASIC1a ( b ), rat <t>ASIC2a</t> ( c ) or rat ASIC3 ( d ) in oocytes at a molar RNA ratio of 1:1 (for ASIC3 of 2:1). Cells were illuminated with 560 nm light at different holding voltages at 0.1 mM MOPS and pH 7.5 under constant perfusion. The small outward directed pump currents (CsR) triggers large inward sodium currents (ASIC). Inset is a zoom-in to the initial pump activity directly after starting to illuminate CsR T46N -ASIC1a with green light. Note that ASIC1a and ASIC3 show strong inactivation in sustained light, whereas ASIC2a shows moderate to no inactivation at all.
Protein Sequence Of Rat Asic2a, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protein sequence of rat asic2a/product/GenScript corporation
Average 90 stars, based on 1 article reviews
protein sequence of rat asic2a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sanofi pcdna3-ha full-length tap73h
( a ) Principle of the two-component optogenetic (TCO) approach. Upon illumination the light-activated proton pump may moderately acidify the local extracellular medium and activate acid-sensitive ion channels, ASICs, via their proton-sensing domain. This results in a remote but large sodium influx that can be used for sustained cell depolarization at moderate light intensities. In Xenopus oocytes, a light-driven proton pump of Coccomyxa subellipsoidea (CsR) was used. ( b–d ) Macroscopic currents of CsR T46N coexpressed with rat ASIC1a ( b ), rat <t>ASIC2a</t> ( c ) or rat ASIC3 ( d ) in oocytes at a molar RNA ratio of 1:1 (for ASIC3 of 2:1). Cells were illuminated with 560 nm light at different holding voltages at 0.1 mM MOPS and pH 7.5 under constant perfusion. The small outward directed pump currents (CsR) triggers large inward sodium currents (ASIC). Inset is a zoom-in to the initial pump activity directly after starting to illuminate CsR T46N -ASIC1a with green light. Note that ASIC1a and ASIC3 show strong inactivation in sustained light, whereas ASIC2a shows moderate to no inactivation at all.
Pcdna3 Ha Full Length Tap73h, supplied by Sanofi, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3-ha full-length tap73h/product/Sanofi
Average 90 stars, based on 1 article reviews
pcdna3-ha full-length tap73h - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Alpha Diagnostics asic2a
( a ) Principle of the two-component optogenetic (TCO) approach. Upon illumination the light-activated proton pump may moderately acidify the local extracellular medium and activate acid-sensitive ion channels, ASICs, via their proton-sensing domain. This results in a remote but large sodium influx that can be used for sustained cell depolarization at moderate light intensities. In Xenopus oocytes, a light-driven proton pump of Coccomyxa subellipsoidea (CsR) was used. ( b–d ) Macroscopic currents of CsR T46N coexpressed with rat ASIC1a ( b ), rat <t>ASIC2a</t> ( c ) or rat ASIC3 ( d ) in oocytes at a molar RNA ratio of 1:1 (for ASIC3 of 2:1). Cells were illuminated with 560 nm light at different holding voltages at 0.1 mM MOPS and pH 7.5 under constant perfusion. The small outward directed pump currents (CsR) triggers large inward sodium currents (ASIC). Inset is a zoom-in to the initial pump activity directly after starting to illuminate CsR T46N -ASIC1a with green light. Note that ASIC1a and ASIC3 show strong inactivation in sustained light, whereas ASIC2a shows moderate to no inactivation at all.
Asic2a, supplied by Alpha Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/asic2a/product/Alpha Diagnostics
Average 90 stars, based on 1 article reviews
asic2a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Molecular Biosciences Inc recombinant asic2a
( a ) Principle of the two-component optogenetic (TCO) approach. Upon illumination the light-activated proton pump may moderately acidify the local extracellular medium and activate acid-sensitive ion channels, ASICs, via their proton-sensing domain. This results in a remote but large sodium influx that can be used for sustained cell depolarization at moderate light intensities. In Xenopus oocytes, a light-driven proton pump of Coccomyxa subellipsoidea (CsR) was used. ( b–d ) Macroscopic currents of CsR T46N coexpressed with rat ASIC1a ( b ), rat <t>ASIC2a</t> ( c ) or rat ASIC3 ( d ) in oocytes at a molar RNA ratio of 1:1 (for ASIC3 of 2:1). Cells were illuminated with 560 nm light at different holding voltages at 0.1 mM MOPS and pH 7.5 under constant perfusion. The small outward directed pump currents (CsR) triggers large inward sodium currents (ASIC). Inset is a zoom-in to the initial pump activity directly after starting to illuminate CsR T46N -ASIC1a with green light. Note that ASIC1a and ASIC3 show strong inactivation in sustained light, whereas ASIC2a shows moderate to no inactivation at all.
Recombinant Asic2a, supplied by Molecular Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant asic2a/product/Molecular Biosciences Inc
Average 90 stars, based on 1 article reviews
recombinant asic2a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega asic2a
Inward currents activated by rapid application of extracellular acid (pH 4.5) recorded from Xenopus oocytes injected with 1 ng of cRNA corresponding to the <t>ASIC2a</t> coding sequence of wild-type or ASIC2 knockout mice. The wild-type ASIC2a sequence was identical to that in the databases (GenBank accession no. AAK40101). In the ASIC2 knockout mice, exon 8 is deleted, leading to a frame-shift before TM2. The carboxy terminus of the targeted ASIC2 protein is 421KAYEVAALLADQREAIRPAWQRRRGREP. The initial pH was 7.4 and the holding potential was −60 mV. Inset, ASIC2a protein cannot be detected in ASIC2 null mice. Western Blot with an antibody directed against the ASIC2a NH2 terminus. ASIC3 COS, ASIC2a COS, 6 μg homogenate from ASIC3 or ASIC2a transfected COS cells, respectively; +/+ and −/−, 20 μg brain homogenate from ASIC2+/+ or ASIC2−/− mice. Neither ASIC2a nor the 7 kDa shorter protein for which the targeted ASIC2 transcript codes are detected in ASIC2−/− mice. The major band of about 70 kDa labelled in brain homogenate from both ASIC2+/+ and ASIC2−/− mice is probably due to a cross-reactivity of the anti-ASIC2a antibody with an unrelated protein. No labelling was obtained in the absence of the anti-ASIC2a antibody (not shown).
Asic2a, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/asic2a/product/Promega
Average 90 stars, based on 1 article reviews
asic2a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Alomone Labs anti-asic2a-atto fluor-594 antibody
Inward currents activated by rapid application of extracellular acid (pH 4.5) recorded from Xenopus oocytes injected with 1 ng of cRNA corresponding to the <t>ASIC2a</t> coding sequence of wild-type or ASIC2 knockout mice. The wild-type ASIC2a sequence was identical to that in the databases (GenBank accession no. AAK40101). In the ASIC2 knockout mice, exon 8 is deleted, leading to a frame-shift before TM2. The carboxy terminus of the targeted ASIC2 protein is 421KAYEVAALLADQREAIRPAWQRRRGREP. The initial pH was 7.4 and the holding potential was −60 mV. Inset, ASIC2a protein cannot be detected in ASIC2 null mice. Western Blot with an antibody directed against the ASIC2a NH2 terminus. ASIC3 COS, ASIC2a COS, 6 μg homogenate from ASIC3 or ASIC2a transfected COS cells, respectively; +/+ and −/−, 20 μg brain homogenate from ASIC2+/+ or ASIC2−/− mice. Neither ASIC2a nor the 7 kDa shorter protein for which the targeted ASIC2 transcript codes are detected in ASIC2−/− mice. The major band of about 70 kDa labelled in brain homogenate from both ASIC2+/+ and ASIC2−/− mice is probably due to a cross-reactivity of the anti-ASIC2a antibody with an unrelated protein. No labelling was obtained in the absence of the anti-ASIC2a antibody (not shown).
Anti Asic2a Atto Fluor 594 Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-asic2a-atto fluor-594 antibody/product/Alomone Labs
Average 90 stars, based on 1 article reviews
anti-asic2a-atto fluor-594 antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma small interfering rna (sirna) against asic2a
Inward currents activated by rapid application of extracellular acid (pH 4.5) recorded from Xenopus oocytes injected with 1 ng of cRNA corresponding to the <t>ASIC2a</t> coding sequence of wild-type or ASIC2 knockout mice. The wild-type ASIC2a sequence was identical to that in the databases (GenBank accession no. AAK40101). In the ASIC2 knockout mice, exon 8 is deleted, leading to a frame-shift before TM2. The carboxy terminus of the targeted ASIC2 protein is 421KAYEVAALLADQREAIRPAWQRRRGREP. The initial pH was 7.4 and the holding potential was −60 mV. Inset, ASIC2a protein cannot be detected in ASIC2 null mice. Western Blot with an antibody directed against the ASIC2a NH2 terminus. ASIC3 COS, ASIC2a COS, 6 μg homogenate from ASIC3 or ASIC2a transfected COS cells, respectively; +/+ and −/−, 20 μg brain homogenate from ASIC2+/+ or ASIC2−/− mice. Neither ASIC2a nor the 7 kDa shorter protein for which the targeted ASIC2 transcript codes are detected in ASIC2−/− mice. The major band of about 70 kDa labelled in brain homogenate from both ASIC2+/+ and ASIC2−/− mice is probably due to a cross-reactivity of the anti-ASIC2a antibody with an unrelated protein. No labelling was obtained in the absence of the anti-ASIC2a antibody (not shown).
Small Interfering Rna (Sirna) Against Asic2a, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/small interfering rna (sirna) against asic2a/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
small interfering rna (sirna) against asic2a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
BioTeZ Inc asic2a primers cggaccccaccgtgct nd tgcttcggtttgtagtgtttgaa
Inward currents activated by rapid application of extracellular acid (pH 4.5) recorded from Xenopus oocytes injected with 1 ng of cRNA corresponding to the <t>ASIC2a</t> coding sequence of wild-type or ASIC2 knockout mice. The wild-type ASIC2a sequence was identical to that in the databases (GenBank accession no. AAK40101). In the ASIC2 knockout mice, exon 8 is deleted, leading to a frame-shift before TM2. The carboxy terminus of the targeted ASIC2 protein is 421KAYEVAALLADQREAIRPAWQRRRGREP. The initial pH was 7.4 and the holding potential was −60 mV. Inset, ASIC2a protein cannot be detected in ASIC2 null mice. Western Blot with an antibody directed against the ASIC2a NH2 terminus. ASIC3 COS, ASIC2a COS, 6 μg homogenate from ASIC3 or ASIC2a transfected COS cells, respectively; +/+ and −/−, 20 μg brain homogenate from ASIC2+/+ or ASIC2−/− mice. Neither ASIC2a nor the 7 kDa shorter protein for which the targeted ASIC2 transcript codes are detected in ASIC2−/− mice. The major band of about 70 kDa labelled in brain homogenate from both ASIC2+/+ and ASIC2−/− mice is probably due to a cross-reactivity of the anti-ASIC2a antibody with an unrelated protein. No labelling was obtained in the absence of the anti-ASIC2a antibody (not shown).
Asic2a Primers Cggaccccaccgtgct Nd Tgcttcggtttgtagtgtttgaa, supplied by BioTeZ Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/asic2a primers cggaccccaccgtgct nd tgcttcggtttgtagtgtttgaa/product/BioTeZ Inc
Average 90 stars, based on 1 article reviews
asic2a primers cggaccccaccgtgct nd tgcttcggtttgtagtgtttgaa - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


ASIC1 and ASIC2a are located at the mouse NMJ. A. All of the images shown are maximum projections of 16 images collected at 0.5 μm increments vertically through the field containing the NMJ. α-bungarotoxin (α -BTX) is shown in Red. ASIC2a antibodies are in Green. Arrows point to clusters of ASIC2a staining that are outside the area defining the motor nerve terminal but near perisynaptic Schwann cell nuclei, indicated by the DAPI stain (Blue). Calibration bar, 10 μm. B. All of the images shown are maximum projections of 18 images collected at 0.5 μm increments vertically through the field containing the NMJ. α-bungarotoxin (α -BTX) is shown in Red. ASIC1 antibodies are in Green. Arrows point to clusters of ASIC2a staining that are outside the area defining the motor nerve terminal but near perisynaptic Schwann cell nuclei, indicated by the DAPI stain (Blue). Calibration bar, 10 μm.

Journal: Neuroscience

Article Title: Extracellular Protons Mediate Presynaptic Homeostatic Potentiation at the Mouse Neuromuscular Junction

doi: 10.1016/j.neuroscience.2021.01.036

Figure Lengend Snippet: ASIC1 and ASIC2a are located at the mouse NMJ. A. All of the images shown are maximum projections of 16 images collected at 0.5 μm increments vertically through the field containing the NMJ. α-bungarotoxin (α -BTX) is shown in Red. ASIC2a antibodies are in Green. Arrows point to clusters of ASIC2a staining that are outside the area defining the motor nerve terminal but near perisynaptic Schwann cell nuclei, indicated by the DAPI stain (Blue). Calibration bar, 10 μm. B. All of the images shown are maximum projections of 18 images collected at 0.5 μm increments vertically through the field containing the NMJ. α-bungarotoxin (α -BTX) is shown in Red. ASIC1 antibodies are in Green. Arrows point to clusters of ASIC2a staining that are outside the area defining the motor nerve terminal but near perisynaptic Schwann cell nuclei, indicated by the DAPI stain (Blue). Calibration bar, 10 μm.

Article Snippet: When we applied antibodies to the ASIC2a subunit (ASC-012, Alomone Labs, Jerusalem) we observed clear staining at the NMJ.

Techniques: Staining

( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total ASIC2 expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.

Journal: Scientific Reports

Article Title: Syntabulin regulates the trafficking of PICK1-containing vesicles in neurons

doi: 10.1038/srep20924

Figure Lengend Snippet: ( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total ASIC2 expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.

Article Snippet: The following antibodies were purchased: rabbit polyclonal ASIC2 antibody, Proteintech (17851-1-AP); mouse myc and β-tubulin antibodies, DSHB (9E10 and E7); mouse GAPDH antibody, Beyotime (GA019); mouse Map2 antibody, Sigma (M9942); and mouse β-actin antibody, Sigma (A5316).

Techniques: Infection, shRNA, Knockdown, Expressing, Control, Staining

( a ) Principle of the two-component optogenetic (TCO) approach. Upon illumination the light-activated proton pump may moderately acidify the local extracellular medium and activate acid-sensitive ion channels, ASICs, via their proton-sensing domain. This results in a remote but large sodium influx that can be used for sustained cell depolarization at moderate light intensities. In Xenopus oocytes, a light-driven proton pump of Coccomyxa subellipsoidea (CsR) was used. ( b–d ) Macroscopic currents of CsR T46N coexpressed with rat ASIC1a ( b ), rat ASIC2a ( c ) or rat ASIC3 ( d ) in oocytes at a molar RNA ratio of 1:1 (for ASIC3 of 2:1). Cells were illuminated with 560 nm light at different holding voltages at 0.1 mM MOPS and pH 7.5 under constant perfusion. The small outward directed pump currents (CsR) triggers large inward sodium currents (ASIC). Inset is a zoom-in to the initial pump activity directly after starting to illuminate CsR T46N -ASIC1a with green light. Note that ASIC1a and ASIC3 show strong inactivation in sustained light, whereas ASIC2a shows moderate to no inactivation at all.

Journal: Scientific Reports

Article Title: Optogenetic approaches addressing extracellular modulation of neural excitability

doi: 10.1038/srep23947

Figure Lengend Snippet: ( a ) Principle of the two-component optogenetic (TCO) approach. Upon illumination the light-activated proton pump may moderately acidify the local extracellular medium and activate acid-sensitive ion channels, ASICs, via their proton-sensing domain. This results in a remote but large sodium influx that can be used for sustained cell depolarization at moderate light intensities. In Xenopus oocytes, a light-driven proton pump of Coccomyxa subellipsoidea (CsR) was used. ( b–d ) Macroscopic currents of CsR T46N coexpressed with rat ASIC1a ( b ), rat ASIC2a ( c ) or rat ASIC3 ( d ) in oocytes at a molar RNA ratio of 1:1 (for ASIC3 of 2:1). Cells were illuminated with 560 nm light at different holding voltages at 0.1 mM MOPS and pH 7.5 under constant perfusion. The small outward directed pump currents (CsR) triggers large inward sodium currents (ASIC). Inset is a zoom-in to the initial pump activity directly after starting to illuminate CsR T46N -ASIC1a with green light. Note that ASIC1a and ASIC3 show strong inactivation in sustained light, whereas ASIC2a shows moderate to no inactivation at all.

Article Snippet: The protein sequence of rat ASIC2a (Genbank accession number AX286636) was human codon optimized and synthesized by Genscript. eArch3.0 and ASIC-YFP fusions were cloned into an AAV2 backbone either under a CaMKIIα or human synapsin promoter.

Techniques: Activity Assay

( a ) Current-voltage dependency of normalized photocurrents in 100 mM NaCl, 100 mM KCl or 100 mM CholineCl extracellular medium (all media contained additionally 1mM NaCl/KCl, 1 mM MgCl 2 , 0.1 mM CaCl 2 and 0.1 mM MOPS, pH 7.5, normalized to ASIC2a current activated by pH 4, mean +/− SD, n = 5). ( b ) ASIC2a currents measured during pH titration in darkness and comparison with photocurrents measured at pH 7.5 (mean +/− SD, n = 6). The green shaded region highlights the percent activation of ASIC2a by illumination with green light at 0.1 mM MOPS at −40 mV (data shown in ). Inset: representative pH activated current trace of ASIC2a at −40 mV. ( c ) Macroscopic currents of CsR T46N -ASIC2a activated by pH 4 or green light at different buffer concentrations (5 mM MOPS, 1 mM MOPS and 0.1 mM MOPS, −40 mV, constant perfusion). ( d ) Percent activation of ASIC2a by the light driven proton pump CsR T46N in different buffer concentrations (5 mM MOPS, 1 mM MOPS and 0.1 mM MOPS, −40 mV, n = 9, 100% activation taken as the peak ASIC current produced by pH 4, mean +/− SD, n = 9). ( e ) Normalized ASIC2a (red data points) and CsR T46N (green data points) photocurrents measured at different light intensities (0.1 mM MOPS, −40 mV, normalized to ASIC2a current activated by pH 4, mean +/− SD, n = 5). Inset: representative current traces at −40 mV.

Journal: Scientific Reports

Article Title: Optogenetic approaches addressing extracellular modulation of neural excitability

doi: 10.1038/srep23947

Figure Lengend Snippet: ( a ) Current-voltage dependency of normalized photocurrents in 100 mM NaCl, 100 mM KCl or 100 mM CholineCl extracellular medium (all media contained additionally 1mM NaCl/KCl, 1 mM MgCl 2 , 0.1 mM CaCl 2 and 0.1 mM MOPS, pH 7.5, normalized to ASIC2a current activated by pH 4, mean +/− SD, n = 5). ( b ) ASIC2a currents measured during pH titration in darkness and comparison with photocurrents measured at pH 7.5 (mean +/− SD, n = 6). The green shaded region highlights the percent activation of ASIC2a by illumination with green light at 0.1 mM MOPS at −40 mV (data shown in ). Inset: representative pH activated current trace of ASIC2a at −40 mV. ( c ) Macroscopic currents of CsR T46N -ASIC2a activated by pH 4 or green light at different buffer concentrations (5 mM MOPS, 1 mM MOPS and 0.1 mM MOPS, −40 mV, constant perfusion). ( d ) Percent activation of ASIC2a by the light driven proton pump CsR T46N in different buffer concentrations (5 mM MOPS, 1 mM MOPS and 0.1 mM MOPS, −40 mV, n = 9, 100% activation taken as the peak ASIC current produced by pH 4, mean +/− SD, n = 9). ( e ) Normalized ASIC2a (red data points) and CsR T46N (green data points) photocurrents measured at different light intensities (0.1 mM MOPS, −40 mV, normalized to ASIC2a current activated by pH 4, mean +/− SD, n = 5). Inset: representative current traces at −40 mV.

Article Snippet: The protein sequence of rat ASIC2a (Genbank accession number AX286636) was human codon optimized and synthesized by Genscript. eArch3.0 and ASIC-YFP fusions were cloned into an AAV2 backbone either under a CaMKIIα or human synapsin promoter.

Techniques: Titration, Comparison, Activation Assay, Produced

( a ) Two-component Champ2.0 construct containing eArch (enhanced by trafficking sequence, TS) and ASIC2a, separated by a linker sequence and labeled with YFP. ( b ) Champ2.0 expression under CamKIIα or human synapsin (hSyn) promoters. ( c ) Representative voltage clamp trace for a Champ-expressing cell in response to a 1 s pulse of 560 nm light (green horizontal line). ( d ) Magnitude of outward (mean +/− SEM = 246 +/− 27 pA) and inward (−950 +/− 172 pA) components of the Champ current to a 1 s pulse of 560 nm light (n = 21). ( e ) Relationship between inward and outward components of the current (n = 21). Linear regression analysis yields R 2 = 0.33, p = 0.006 for difference of slope from zero (F(1, 19) = 9.447). ( f ) Example Champ responses to a 15 s light pulse in standard (25 mM HEPES, black trace) and weakly buffered (0.1 mM HEPES, grey trace) extracellular solution. ( g ) Peak inward currents in 25 and 0.1 mM HEPES for 1 s and 15 s light pulses. For 15 s light pulses, mean inward current is −164 pA +/−45 at 25 mM (n = 5) versus −379.9 +/−83 pA at 0.1 mM (n = 6), unpaired t-test with Welch’s correction: t = 2.278, df = 7.558, p = 0.0541). ( h ) Decay of inward current (final to peak current ratio for 15 s light pulse) in 25 mM (n = 5) versus 0.1 mM HEPES (n = 6), unpaired t-test with Welch’s correction: t = 4.779, df = 5.997, p = 0.0031. ( i ) Example membrane potential response to 1 s pulse of 560 nm light (green horizontal line) for a Champ expressing cell recorded in current clamp. ( j ) Magnitude of hyperpolarizing (eArch3.0-mediated, −33 +/− 3 mV) and depolarizing (ASIC2a-mediated, 87 +/− 6 mV) components of the light response (n = 13). ( k ) Relationship between Champ-mediated membrane hyperpolarization and depolarization (for 1 s light pulses). Linear regression analysis yields R 2 = 0.47, p = 0.0093 for difference of slope from zero (F(1, 11) = 9.885).

Journal: Scientific Reports

Article Title: Optogenetic approaches addressing extracellular modulation of neural excitability

doi: 10.1038/srep23947

Figure Lengend Snippet: ( a ) Two-component Champ2.0 construct containing eArch (enhanced by trafficking sequence, TS) and ASIC2a, separated by a linker sequence and labeled with YFP. ( b ) Champ2.0 expression under CamKIIα or human synapsin (hSyn) promoters. ( c ) Representative voltage clamp trace for a Champ-expressing cell in response to a 1 s pulse of 560 nm light (green horizontal line). ( d ) Magnitude of outward (mean +/− SEM = 246 +/− 27 pA) and inward (−950 +/− 172 pA) components of the Champ current to a 1 s pulse of 560 nm light (n = 21). ( e ) Relationship between inward and outward components of the current (n = 21). Linear regression analysis yields R 2 = 0.33, p = 0.006 for difference of slope from zero (F(1, 19) = 9.447). ( f ) Example Champ responses to a 15 s light pulse in standard (25 mM HEPES, black trace) and weakly buffered (0.1 mM HEPES, grey trace) extracellular solution. ( g ) Peak inward currents in 25 and 0.1 mM HEPES for 1 s and 15 s light pulses. For 15 s light pulses, mean inward current is −164 pA +/−45 at 25 mM (n = 5) versus −379.9 +/−83 pA at 0.1 mM (n = 6), unpaired t-test with Welch’s correction: t = 2.278, df = 7.558, p = 0.0541). ( h ) Decay of inward current (final to peak current ratio for 15 s light pulse) in 25 mM (n = 5) versus 0.1 mM HEPES (n = 6), unpaired t-test with Welch’s correction: t = 4.779, df = 5.997, p = 0.0031. ( i ) Example membrane potential response to 1 s pulse of 560 nm light (green horizontal line) for a Champ expressing cell recorded in current clamp. ( j ) Magnitude of hyperpolarizing (eArch3.0-mediated, −33 +/− 3 mV) and depolarizing (ASIC2a-mediated, 87 +/− 6 mV) components of the light response (n = 13). ( k ) Relationship between Champ-mediated membrane hyperpolarization and depolarization (for 1 s light pulses). Linear regression analysis yields R 2 = 0.47, p = 0.0093 for difference of slope from zero (F(1, 11) = 9.885).

Article Snippet: The protein sequence of rat ASIC2a (Genbank accession number AX286636) was human codon optimized and synthesized by Genscript. eArch3.0 and ASIC-YFP fusions were cloned into an AAV2 backbone either under a CaMKIIα or human synapsin promoter.

Techniques: Construct, Sequencing, Labeling, Expressing, Membrane

For each construct: a cartoon illustrates the structure of the two-component construct, confocal images demonstrate fluorescence expression in culture and graphs show the relative magnitude of the peak outward current and the current at the end of the light pulse. A more negative current at the end of the light pulse indicates a larger ASIC component. Insets: representative traces of the current responses to a 1 s pulse of 560 nm light for each two-component construct (timing of light pulse indicated by green horizontal line). All electrophysiological recordings were performed in low HEPES (0.1 mM) Tyrode’s solution. ( a ) eArch3.0-YFP only control (n = 9). ( b ) Co-transfection of eArch3.0 and ASIC2a: eArch3.0 is labeled with mCherry and ASIC2a is labeled with YFP to allow identification of both components in a single cell (n = 9). ( c ) Champ1.0: eArch3.0 and ASIC2a are separated during protein translation by the ribosomal skip sequence, p2A (n = 14). ( d ) Champ2.0: eArch3.0 and ASIC2a are fused by a 41 amino acid linker sequence (n = 17). ( e ) Champ3.0: eArch3.0 and ASIC2a are fused by a short linker sequence (23 amino acid membrane trafficking signal, TS) (n = 16).

Journal: Scientific Reports

Article Title: Optogenetic approaches addressing extracellular modulation of neural excitability

doi: 10.1038/srep23947

Figure Lengend Snippet: For each construct: a cartoon illustrates the structure of the two-component construct, confocal images demonstrate fluorescence expression in culture and graphs show the relative magnitude of the peak outward current and the current at the end of the light pulse. A more negative current at the end of the light pulse indicates a larger ASIC component. Insets: representative traces of the current responses to a 1 s pulse of 560 nm light for each two-component construct (timing of light pulse indicated by green horizontal line). All electrophysiological recordings were performed in low HEPES (0.1 mM) Tyrode’s solution. ( a ) eArch3.0-YFP only control (n = 9). ( b ) Co-transfection of eArch3.0 and ASIC2a: eArch3.0 is labeled with mCherry and ASIC2a is labeled with YFP to allow identification of both components in a single cell (n = 9). ( c ) Champ1.0: eArch3.0 and ASIC2a are separated during protein translation by the ribosomal skip sequence, p2A (n = 14). ( d ) Champ2.0: eArch3.0 and ASIC2a are fused by a 41 amino acid linker sequence (n = 17). ( e ) Champ3.0: eArch3.0 and ASIC2a are fused by a short linker sequence (23 amino acid membrane trafficking signal, TS) (n = 16).

Article Snippet: The protein sequence of rat ASIC2a (Genbank accession number AX286636) was human codon optimized and synthesized by Genscript. eArch3.0 and ASIC-YFP fusions were cloned into an AAV2 backbone either under a CaMKIIα or human synapsin promoter.

Techniques: Construct, Fluorescence, Expressing, Control, Cotransfection, Labeling, Sequencing, Membrane

( a , b ) ASIC1 ( a ) and ASIC2a ( b ) expression in CA1. ( c ) Change in membrane resistance during amiloride (ASIC antagonist) application (lilac-shaded region) (n = 6–18 cells, 9 mice, two-way ANOVA for interaction between time and drug treatment (F (12,314) = 2.617, p = 0.0018, asterisks indicate significant time points after Dunnet’s multiple comparison test). Grey data points: control experiment in which no amiloride was applied (n = 4–16, 6 mice) (no significant change from baseline). ( d ) Change in bystander current during amiloride application (F (12,314) = 2.473, p = 0.0032, asterisks indicate significant time points). No significant change from baseline for untreated control cells. ( e ) Examples bystander current at baseline baseline (dark red), after 20 mins amiloride (pink), and after 30 mins of washout (lilac). ( f ) Example ChR2 and eArch3.0 bystander currents in 500 μM acetazolamide (pale traces indicate baseline recordings, dark traces indicate 15 mins acetazolamide exposure). ( g ) Change in bystander current magnitude after acetazolamide application (thick line represents group mean) (ChR2, n = 7 cells, 3 mice, paired t-test: t = 1.313, df = 6, p = 0.2372; eArch3.0, n = 7 cells, 3 mice, paired t-test: t = 6.177, df = 6, p = 0.0008). ( h ) Occasionally, acetazolamide caused eArch3.0 bystander neurons to exhibit inward ASIC-like currents during green light. ( i ) Extracellular pH measurements in CA1 (contralateral to site of opsin injection) in acute slices using a solid state metal wire oxide pH sensor (100 μm diameter, 5X magnification). ( j ) pH change in response to three minutes of light stimulation (470 nm for ChR2 and YFP-controls, 560 nm for eArch3.0). For ChR2, n = 24 recording sites, 13 slices, 3 animals. For eArch3.0, n = 21 recording sites, 11 slices, 3 animals. For YFP controls, n = 22 recording sites, 12 slices, 2 animals. ( k ) Zoom-in of last minute of baseline pH recording and first two minutes of light stimulation.

Journal: Scientific Reports

Article Title: Optogenetic approaches addressing extracellular modulation of neural excitability

doi: 10.1038/srep23947

Figure Lengend Snippet: ( a , b ) ASIC1 ( a ) and ASIC2a ( b ) expression in CA1. ( c ) Change in membrane resistance during amiloride (ASIC antagonist) application (lilac-shaded region) (n = 6–18 cells, 9 mice, two-way ANOVA for interaction between time and drug treatment (F (12,314) = 2.617, p = 0.0018, asterisks indicate significant time points after Dunnet’s multiple comparison test). Grey data points: control experiment in which no amiloride was applied (n = 4–16, 6 mice) (no significant change from baseline). ( d ) Change in bystander current during amiloride application (F (12,314) = 2.473, p = 0.0032, asterisks indicate significant time points). No significant change from baseline for untreated control cells. ( e ) Examples bystander current at baseline baseline (dark red), after 20 mins amiloride (pink), and after 30 mins of washout (lilac). ( f ) Example ChR2 and eArch3.0 bystander currents in 500 μM acetazolamide (pale traces indicate baseline recordings, dark traces indicate 15 mins acetazolamide exposure). ( g ) Change in bystander current magnitude after acetazolamide application (thick line represents group mean) (ChR2, n = 7 cells, 3 mice, paired t-test: t = 1.313, df = 6, p = 0.2372; eArch3.0, n = 7 cells, 3 mice, paired t-test: t = 6.177, df = 6, p = 0.0008). ( h ) Occasionally, acetazolamide caused eArch3.0 bystander neurons to exhibit inward ASIC-like currents during green light. ( i ) Extracellular pH measurements in CA1 (contralateral to site of opsin injection) in acute slices using a solid state metal wire oxide pH sensor (100 μm diameter, 5X magnification). ( j ) pH change in response to three minutes of light stimulation (470 nm for ChR2 and YFP-controls, 560 nm for eArch3.0). For ChR2, n = 24 recording sites, 13 slices, 3 animals. For eArch3.0, n = 21 recording sites, 11 slices, 3 animals. For YFP controls, n = 22 recording sites, 12 slices, 2 animals. ( k ) Zoom-in of last minute of baseline pH recording and first two minutes of light stimulation.

Article Snippet: The protein sequence of rat ASIC2a (Genbank accession number AX286636) was human codon optimized and synthesized by Genscript. eArch3.0 and ASIC-YFP fusions were cloned into an AAV2 backbone either under a CaMKIIα or human synapsin promoter.

Techniques: Expressing, Membrane, Comparison, Control, Injection

Inward currents activated by rapid application of extracellular acid (pH 4.5) recorded from Xenopus oocytes injected with 1 ng of cRNA corresponding to the ASIC2a coding sequence of wild-type or ASIC2 knockout mice. The wild-type ASIC2a sequence was identical to that in the databases (GenBank accession no. AAK40101). In the ASIC2 knockout mice, exon 8 is deleted, leading to a frame-shift before TM2. The carboxy terminus of the targeted ASIC2 protein is 421KAYEVAALLADQREAIRPAWQRRRGREP. The initial pH was 7.4 and the holding potential was −60 mV. Inset, ASIC2a protein cannot be detected in ASIC2 null mice. Western Blot with an antibody directed against the ASIC2a NH2 terminus. ASIC3 COS, ASIC2a COS, 6 μg homogenate from ASIC3 or ASIC2a transfected COS cells, respectively; +/+ and −/−, 20 μg brain homogenate from ASIC2+/+ or ASIC2−/− mice. Neither ASIC2a nor the 7 kDa shorter protein for which the targeted ASIC2 transcript codes are detected in ASIC2−/− mice. The major band of about 70 kDa labelled in brain homogenate from both ASIC2+/+ and ASIC2−/− mice is probably due to a cross-reactivity of the anti-ASIC2a antibody with an unrelated protein. No labelling was obtained in the absence of the anti-ASIC2a antibody (not shown).

Journal:

Article Title: Knockout of the ASIC2 channel in mice does not impair cutaneous mechanosensation, visceral mechanonociception and hearing

doi: 10.1113/jphysiol.2004.066001

Figure Lengend Snippet: Inward currents activated by rapid application of extracellular acid (pH 4.5) recorded from Xenopus oocytes injected with 1 ng of cRNA corresponding to the ASIC2a coding sequence of wild-type or ASIC2 knockout mice. The wild-type ASIC2a sequence was identical to that in the databases (GenBank accession no. AAK40101). In the ASIC2 knockout mice, exon 8 is deleted, leading to a frame-shift before TM2. The carboxy terminus of the targeted ASIC2 protein is 421KAYEVAALLADQREAIRPAWQRRRGREP. The initial pH was 7.4 and the holding potential was −60 mV. Inset, ASIC2a protein cannot be detected in ASIC2 null mice. Western Blot with an antibody directed against the ASIC2a NH2 terminus. ASIC3 COS, ASIC2a COS, 6 μg homogenate from ASIC3 or ASIC2a transfected COS cells, respectively; +/+ and −/−, 20 μg brain homogenate from ASIC2+/+ or ASIC2−/− mice. Neither ASIC2a nor the 7 kDa shorter protein for which the targeted ASIC2 transcript codes are detected in ASIC2−/− mice. The major band of about 70 kDa labelled in brain homogenate from both ASIC2+/+ and ASIC2−/− mice is probably due to a cross-reactivity of the anti-ASIC2a antibody with an unrelated protein. No labelling was obtained in the absence of the anti-ASIC2a antibody (not shown).

Article Snippet: Briefly, total protein was prepared from mouse brain and from COS cells (monkey kidney cell line) transfected with an ASIC2a or ASIC3 expression vector (PCI, Promega, France).

Techniques: Injection, Sequencing, Knock-Out, Western Blot, Transfection