asic2 Search Results


96
Thermo Fisher gene exp asic2 mm00475691 m1
Gene Exp Asic2 Mm00475691 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp asic2 mm00475691 m1/product/Thermo Fisher
Average 96 stars, based on 1 article reviews
gene exp asic2 mm00475691 m1 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

93
Proteintech rabbit polyclonal asic2 antibody
( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total <t>ASIC2</t> expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.
Rabbit Polyclonal Asic2 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal asic2 antibody/product/Proteintech
Average 93 stars, based on 1 article reviews
rabbit polyclonal asic2 antibody - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp asic2 rn00563654 m1
Primers and Taqman Gene Assay Kits Used in This Study
Gene Exp Asic2 Rn00563654 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp asic2 rn00563654 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp asic2 rn00563654 m1 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp asic2 hs00153756 m1
ASIC1 and ASIC3 are expressed in GSC lines. ( a ) Left, RT-PCR analysis revealed expression of ACCN2a , ACCN2b and ACCN3 but not <t>ACCN1</t> in R8 and R54 cells respectively. HPRT (hypoxanthine-guanine phosphoribosyltransferase) served as a reference gene. Right, qPCR analysis revealed different expression levels of ACCN2a , ACCN2b and ACCN3 in R8 and R54 cells. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) served as a reference gene. ( b ) Left, western blot analysis revealed expression of ASIC1 and ASIC3 in GSC lines, ß-actin was used as control. Right, summary of four Western blots for ASIC1 and three Western blots for ASIC3; expression was normalized to ß-actin.
Gene Exp Asic2 Hs00153756 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp asic2 hs00153756 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp asic2 hs00153756 m1 - by Bioz Stars, 2026-04
85/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp asic2 mm01304217 m1
ASIC1 and ASIC3 are expressed in GSC lines. ( a ) Left, RT-PCR analysis revealed expression of ACCN2a , ACCN2b and ACCN3 but not <t>ACCN1</t> in R8 and R54 cells respectively. HPRT (hypoxanthine-guanine phosphoribosyltransferase) served as a reference gene. Right, qPCR analysis revealed different expression levels of ACCN2a , ACCN2b and ACCN3 in R8 and R54 cells. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) served as a reference gene. ( b ) Left, western blot analysis revealed expression of ASIC1 and ASIC3 in GSC lines, ß-actin was used as control. Right, summary of four Western blots for ASIC1 and three Western blots for ASIC3; expression was normalized to ß-actin.
Gene Exp Asic2 Mm01304217 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp asic2 mm01304217 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp asic2 mm01304217 m1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Boster Bio asic3
Fig. 1. Changes in ASIC1, ASIC2, and <t>ASIC3</t> protein expression in the spinal dorsal horn during chronic morphine exposure. A, Schematic dia gram of behavioral testing upon morphine treatment. B, During nine days of chronic morphine exposure (10 mg/kg twice daily), the MPE percentages of the hot plate test in C57 mice were recorded 30 min after treatment, and the area under the curve (AUC) of MPE % of hot plate latency over the nine days was calculated. ***P < 0.001 compared with Day 1; n = 6 per group. C, During nine days of chronic morphine exposure (10 mg/kg twice daily), the MPE percent ages of the tail flick test in C57 mice were recorded 30 min after treatment, and the area under the curve (AUC) of MPE % of tail-flick latency over the nine days was calculated. ***P < 0.001 compared with Day 1; n = 6 per group. D-I, The mRNA levels (D–F) and protein levels (G–I) of ASICs compared between the saline group and the morphine group; ***P < 0.001; n = 3 per group. Abbre viations: Mor = morphine.
Asic3, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/asic3/product/Boster Bio
Average 93 stars, based on 1 article reviews
asic3 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp asic2 mm00475687 m1
TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.
Gene Exp Asic2 Mm00475687 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp asic2 mm00475687 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp asic2 mm00475687 m1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp asic2 mm01304218 m1
TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.
Gene Exp Asic2 Mm01304218 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp asic2 mm01304218 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp asic2 mm01304218 m1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Quantachrome gmbh n 2 adsorption–desorption measurement quantachrome asic-2
TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.
N 2 Adsorption–Desorption Measurement Quantachrome Asic 2, supplied by Quantachrome gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n 2 adsorption–desorption measurement quantachrome asic-2/product/Quantachrome gmbh
Average 90 stars, based on 1 article reviews
n 2 adsorption–desorption measurement quantachrome asic-2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Keygen Biotech recombinant mouse gst-tagged asic2 extracellular segment [amino-acids (aa) 59–427]
TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.
Recombinant Mouse Gst Tagged Asic2 Extracellular Segment [Amino Acids (Aa) 59–427], supplied by Keygen Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse gst-tagged asic2 extracellular segment [amino-acids (aa) 59–427]/product/Keygen Biotech
Average 90 stars, based on 1 article reviews
recombinant mouse gst-tagged asic2 extracellular segment [amino-acids (aa) 59–427] - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
AnaSpec polyclonal anti-asic2 antibody ish-650
TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.
Polyclonal Anti Asic2 Antibody Ish 650, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal anti-asic2 antibody ish-650/product/AnaSpec
Average 90 stars, based on 1 article reviews
polyclonal anti-asic2 antibody ish-650 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MyBiosource Biotechnology mybiosource asic2
TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.
Mybiosource Asic2, supplied by MyBiosource Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mybiosource asic2/product/MyBiosource Biotechnology
Average 90 stars, based on 1 article reviews
mybiosource asic2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total ASIC2 expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.

Journal: Scientific Reports

Article Title: Syntabulin regulates the trafficking of PICK1-containing vesicles in neurons

doi: 10.1038/srep20924

Figure Lengend Snippet: ( A ) Neurons were infected with syntabulin shRNA lentivirus as indicated at DIV5 and examined at DIV13. Syntabulin knockdown significantly increased total ASIC2 expression but reduced surface ASIC2 levels as compared with the levels in control and scrambled-shRNA control. ( B ) Quantification of normalized ASIC2/GAPDH ratio, total ASIC2/surface ASIC2 ratio and surface ASIC2 levels. One-way ANOVA and Sidak test; ** P = 0.008, and P = 0.009 for Stb sh#1 Total ASIC2/GAPDH and Surface ASIC2/GAPDH compared to control respectively; * P = 0.044 and * P = 0.016 for Stb #1 total ASIC2/GAPDH and Surface/Total ASIC2 ratio compared to scrambled shRNA control respectively; * P = 0.020 for Stb #1 Surface/Total ASIC2 ratio compared to control; “ns” P > 0.05. n = 4 − 6 independent experiments. Error bars represent the SEM. ( C , D ) Hoechst staining of neurons after syntabulin knockdown, in pH 7.4 solution and pH6.0 solution. Knockdown of syntabulin significantly increased cell death as compared with controls in pH6.0. Scale bar = 20 μm. ( E ) Quantification of normalized total Hoechst intensity. One-way ANOVA and Sidak test; * P = 0.035 compared to control; * P = 0.043 compared to scrambled-shRNA control; “ns” P > 0.05; n = 6 independent experimental repeats. Error bars represent the SEM.

Article Snippet: The following antibodies were purchased: rabbit polyclonal ASIC2 antibody, Proteintech (17851-1-AP); mouse myc and β-tubulin antibodies, DSHB (9E10 and E7); mouse GAPDH antibody, Beyotime (GA019); mouse Map2 antibody, Sigma (M9942); and mouse β-actin antibody, Sigma (A5316).

Techniques: Infection, shRNA, Knockdown, Expressing, Control, Staining

Primers and Taqman Gene Assay Kits Used in This Study

Journal:

Article Title: Characterization of Acid-Sensing Ion Channel Expression in Oligodendrocyte-Lineage Cells

doi: 10.1002/glia.20693

Figure Lengend Snippet: Primers and Taqman Gene Assay Kits Used in This Study

Article Snippet: Agarose (2%) minigels were loaded with 10 μL PCR product, and stained with SYBR Gold (Invitrogen) and imaged with a CCD camera-based gel documentation system (Kodak, Rochester, NY). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Gene name ASIC subtype Forward primer Reverse primer ABI Taqman assay number ACCN1 ASIC2 (nonselective) GGCAACGGGCTGGAGATCAT GCAGCAACTTCATACGCCTTCTTC Rn00563654_m1 ASIC2a GCCAATACCTCCACTCTCCATGG GGCAGGTACTCATCTTGCTGAATGTC ASIC2b TCCAAGGGGGACCTCTACTA CCATCCTCGCCTGAGTTAAA ACCN2 ASIC1 (nonselective) GACCATGAAAGGTGGGACTGGC CTGCTCGATGGTCTCATAGTTGAGG ASIC1a CTTGCCCACATCTTCTCCTATGAGC CATGTTGAAGGGCTTGGGCTTG Rn00577292_m1 ASIC1b Rn01532749_m1 ACCN3 ASIC3 GCTCACGCCTCACACCCAATGA GTGTAGCATTGCCCCATTCGAGT Rn00597579_m1 ACCN4 ASIC4 GCACTCAGCGATGCTGATATCTTCC GGTAGGTATTCCTCCTGCTGGATGTC Rn00573723_m1 GAPDH (NA) Rn99999916_s1 Open in a separate window Primers and Taqman Gene Assay Kits Used in This Study Quantitative RT-PCR was performed using Taqman hydrolysis probes (ABI, Foster City, CA), as specified in .

Techniques: Gene Assay, TaqMan Assay

Expression of ASIC transcripts in cultured OLC detected by RT-PCR. (A) Conventional RT-PCR products visualized after 35 cycles of PCR; total RNA templates from OP, IO, or MO cultures. The primer combinations used were as given in Table 1. The DNA size markers are at 100 base pair intervals. For each gel photograph the expected product size in base pairs, followed (in italics) by the size of the DNA marker indicated by the white arrowheads are: ASIC1a, 375 (300); ASIC2, 641 (600); ASIC3, 267 (200); ASIC4, 332 (300). (B) Summary of quantitative PCR results to compare relative expression of ASIC genes in OLC developmental stages and whole brain. Bars for each gene assay, for each tissue source, represent the mean relative value normalized to GAPDH level from the same tissue, as described in Methods. The error bars are standard errors, derived from three to six separate determinations for each gene/tissue combination. Whole brain (WB) RNA was used for comparison to RNA templates for each OLC developmental stage.

Journal:

Article Title: Characterization of Acid-Sensing Ion Channel Expression in Oligodendrocyte-Lineage Cells

doi: 10.1002/glia.20693

Figure Lengend Snippet: Expression of ASIC transcripts in cultured OLC detected by RT-PCR. (A) Conventional RT-PCR products visualized after 35 cycles of PCR; total RNA templates from OP, IO, or MO cultures. The primer combinations used were as given in Table 1. The DNA size markers are at 100 base pair intervals. For each gel photograph the expected product size in base pairs, followed (in italics) by the size of the DNA marker indicated by the white arrowheads are: ASIC1a, 375 (300); ASIC2, 641 (600); ASIC3, 267 (200); ASIC4, 332 (300). (B) Summary of quantitative PCR results to compare relative expression of ASIC genes in OLC developmental stages and whole brain. Bars for each gene assay, for each tissue source, represent the mean relative value normalized to GAPDH level from the same tissue, as described in Methods. The error bars are standard errors, derived from three to six separate determinations for each gene/tissue combination. Whole brain (WB) RNA was used for comparison to RNA templates for each OLC developmental stage.

Article Snippet: Agarose (2%) minigels were loaded with 10 μL PCR product, and stained with SYBR Gold (Invitrogen) and imaged with a CCD camera-based gel documentation system (Kodak, Rochester, NY). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Gene name ASIC subtype Forward primer Reverse primer ABI Taqman assay number ACCN1 ASIC2 (nonselective) GGCAACGGGCTGGAGATCAT GCAGCAACTTCATACGCCTTCTTC Rn00563654_m1 ASIC2a GCCAATACCTCCACTCTCCATGG GGCAGGTACTCATCTTGCTGAATGTC ASIC2b TCCAAGGGGGACCTCTACTA CCATCCTCGCCTGAGTTAAA ACCN2 ASIC1 (nonselective) GACCATGAAAGGTGGGACTGGC CTGCTCGATGGTCTCATAGTTGAGG ASIC1a CTTGCCCACATCTTCTCCTATGAGC CATGTTGAAGGGCTTGGGCTTG Rn00577292_m1 ASIC1b Rn01532749_m1 ACCN3 ASIC3 GCTCACGCCTCACACCCAATGA GTGTAGCATTGCCCCATTCGAGT Rn00597579_m1 ACCN4 ASIC4 GCACTCAGCGATGCTGATATCTTCC GGTAGGTATTCCTCCTGCTGGATGTC Rn00573723_m1 GAPDH (NA) Rn99999916_s1 Open in a separate window Primers and Taqman Gene Assay Kits Used in This Study Quantitative RT-PCR was performed using Taqman hydrolysis probes (ABI, Foster City, CA), as specified in .

Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Marker, Real-time Polymerase Chain Reaction, Gene Assay, Derivative Assay, Comparison

ASIC1 and ASIC3 are expressed in GSC lines. ( a ) Left, RT-PCR analysis revealed expression of ACCN2a , ACCN2b and ACCN3 but not ACCN1 in R8 and R54 cells respectively. HPRT (hypoxanthine-guanine phosphoribosyltransferase) served as a reference gene. Right, qPCR analysis revealed different expression levels of ACCN2a , ACCN2b and ACCN3 in R8 and R54 cells. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) served as a reference gene. ( b ) Left, western blot analysis revealed expression of ASIC1 and ASIC3 in GSC lines, ß-actin was used as control. Right, summary of four Western blots for ASIC1 and three Western blots for ASIC3; expression was normalized to ß-actin.

Journal: Scientific Reports

Article Title: Glioblastoma cancer stem cell lines express functional acid sensing ion channels ASIC1a and ASIC3

doi: 10.1038/s41598-017-13666-9

Figure Lengend Snippet: ASIC1 and ASIC3 are expressed in GSC lines. ( a ) Left, RT-PCR analysis revealed expression of ACCN2a , ACCN2b and ACCN3 but not ACCN1 in R8 and R54 cells respectively. HPRT (hypoxanthine-guanine phosphoribosyltransferase) served as a reference gene. Right, qPCR analysis revealed different expression levels of ACCN2a , ACCN2b and ACCN3 in R8 and R54 cells. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) served as a reference gene. ( b ) Left, western blot analysis revealed expression of ASIC1 and ASIC3 in GSC lines, ß-actin was used as control. Right, summary of four Western blots for ASIC1 and three Western blots for ASIC3; expression was normalized to ß-actin.

Article Snippet: For quantitative real-time PCR (qPCR), hydrolysis probes (TaqMan probes) for GAPDH (glyceraldehyde-3-phosphate dehydrogenase), ASIC1a, ASIC1b, ASIC2 and ASIC3 were ordered from Applied Biosystems (the assay identification numbers are Hs02758991_g1, Hs00952802_m1, ASIC1B, Hs00153756_m1, Hs00245097_m1).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Western Blot, Control

Expression of ACCN1-3 and Kaplan-Meier survival analyses. All 329 glioma patients with available mRNA data from the Rembrandt database were used to determine the relative expression of ACCN1-3 in human glioma and normal brain and the association of ACCN2 and ACCN3 expression with overall survival. (a) Boxplots illustrating the expression level of ACCN1 (ASIC2, top; p < 0.01, Student´s t-test), ACCN2 (ASIC1, centre), and ACCN3 (ASIC3, bottom) in GBM, oligodendroglioma, astrocytoma, and non-tumour control, respectively. Whiskers display the minimal and maximal values, respectively. *** P < 0.001. (b , c) Kaplan-Meier survival curves of pooled glioma samples (including GBM, oligodendroglioma, and astrocytoma) with high or low expression (above or below the median) of ACCN2 or ACCN3 . (b) Survival depending on high or low ACCN2 expression (P < 0.001, log-rank test). (c) Survival depending on high or low ACCN3 expression (P = 0.003, log-rank test).

Journal: Scientific Reports

Article Title: Glioblastoma cancer stem cell lines express functional acid sensing ion channels ASIC1a and ASIC3

doi: 10.1038/s41598-017-13666-9

Figure Lengend Snippet: Expression of ACCN1-3 and Kaplan-Meier survival analyses. All 329 glioma patients with available mRNA data from the Rembrandt database were used to determine the relative expression of ACCN1-3 in human glioma and normal brain and the association of ACCN2 and ACCN3 expression with overall survival. (a) Boxplots illustrating the expression level of ACCN1 (ASIC2, top; p < 0.01, Student´s t-test), ACCN2 (ASIC1, centre), and ACCN3 (ASIC3, bottom) in GBM, oligodendroglioma, astrocytoma, and non-tumour control, respectively. Whiskers display the minimal and maximal values, respectively. *** P < 0.001. (b , c) Kaplan-Meier survival curves of pooled glioma samples (including GBM, oligodendroglioma, and astrocytoma) with high or low expression (above or below the median) of ACCN2 or ACCN3 . (b) Survival depending on high or low ACCN2 expression (P < 0.001, log-rank test). (c) Survival depending on high or low ACCN3 expression (P = 0.003, log-rank test).

Article Snippet: For quantitative real-time PCR (qPCR), hydrolysis probes (TaqMan probes) for GAPDH (glyceraldehyde-3-phosphate dehydrogenase), ASIC1a, ASIC1b, ASIC2 and ASIC3 were ordered from Applied Biosystems (the assay identification numbers are Hs02758991_g1, Hs00952802_m1, ASIC1B, Hs00153756_m1, Hs00245097_m1).

Techniques: Expressing, Control

Fig. 1. Changes in ASIC1, ASIC2, and ASIC3 protein expression in the spinal dorsal horn during chronic morphine exposure. A, Schematic dia gram of behavioral testing upon morphine treatment. B, During nine days of chronic morphine exposure (10 mg/kg twice daily), the MPE percentages of the hot plate test in C57 mice were recorded 30 min after treatment, and the area under the curve (AUC) of MPE % of hot plate latency over the nine days was calculated. ***P < 0.001 compared with Day 1; n = 6 per group. C, During nine days of chronic morphine exposure (10 mg/kg twice daily), the MPE percent ages of the tail flick test in C57 mice were recorded 30 min after treatment, and the area under the curve (AUC) of MPE % of tail-flick latency over the nine days was calculated. ***P < 0.001 compared with Day 1; n = 6 per group. D-I, The mRNA levels (D–F) and protein levels (G–I) of ASICs compared between the saline group and the morphine group; ***P < 0.001; n = 3 per group. Abbre viations: Mor = morphine.

Journal: European journal of pharmacology

Article Title: Amiloride alleviates morphine tolerance by suppressing ASIC3-dependent neuroinflammation in the spinal cord.

doi: 10.1016/j.ejphar.2023.176173

Figure Lengend Snippet: Fig. 1. Changes in ASIC1, ASIC2, and ASIC3 protein expression in the spinal dorsal horn during chronic morphine exposure. A, Schematic dia gram of behavioral testing upon morphine treatment. B, During nine days of chronic morphine exposure (10 mg/kg twice daily), the MPE percentages of the hot plate test in C57 mice were recorded 30 min after treatment, and the area under the curve (AUC) of MPE % of hot plate latency over the nine days was calculated. ***P < 0.001 compared with Day 1; n = 6 per group. C, During nine days of chronic morphine exposure (10 mg/kg twice daily), the MPE percent ages of the tail flick test in C57 mice were recorded 30 min after treatment, and the area under the curve (AUC) of MPE % of tail-flick latency over the nine days was calculated. ***P < 0.001 compared with Day 1; n = 6 per group. D-I, The mRNA levels (D–F) and protein levels (G–I) of ASICs compared between the saline group and the morphine group; ***P < 0.001; n = 3 per group. Abbre viations: Mor = morphine.

Article Snippet: Antibodies against Asic2 (A04055-1) and Asic3 (BA2745-2) were purchased from Boster Biotechnology (California, USA).

Techniques: Expressing, Hot Plate Test, Tail Flick Test, Saline

Fig. 2. Chronic morphine administration increased ASIC3 immunoreactivity in microglia of the dorsal horn. A-B. On Day 9, the fluorescence density of ASIC3 was evaluated after chronic morphine or saline administration. Scale bar: 20 μm ***P < 0.001 compared with the saline group; n = 4 per group. C. ASIC3 merged with NeuN, Iba1, and GFAP in the dorsal horn by double immunofluorescence staining. Scale bar 20 μm. Abbreviations: Mor = morphine.

Journal: European journal of pharmacology

Article Title: Amiloride alleviates morphine tolerance by suppressing ASIC3-dependent neuroinflammation in the spinal cord.

doi: 10.1016/j.ejphar.2023.176173

Figure Lengend Snippet: Fig. 2. Chronic morphine administration increased ASIC3 immunoreactivity in microglia of the dorsal horn. A-B. On Day 9, the fluorescence density of ASIC3 was evaluated after chronic morphine or saline administration. Scale bar: 20 μm ***P < 0.001 compared with the saline group; n = 4 per group. C. ASIC3 merged with NeuN, Iba1, and GFAP in the dorsal horn by double immunofluorescence staining. Scale bar 20 μm. Abbreviations: Mor = morphine.

Article Snippet: Antibodies against Asic2 (A04055-1) and Asic3 (BA2745-2) were purchased from Boster Biotechnology (California, USA).

Techniques: Fluorescence, Saline, Double Immunofluorescence Staining

Fig. 3. Amiloride effects on morphine-induced antinociception tolerance and ASIC3 expression. A Graphical depiction of the treatment protocol. B–C, Amiloride alleviates chronic morphine tolerance. The hot plate test (B) and tail-flick test (C) were conducted on Days 1, 3, 5, 7, and 9. ***P < 0.001 compared with the morphine group; n = 6 per group. D-E, The area under the curve (AUC) for the %MPE of hot plate latency (D) and tail flick latency (E) was calculated over nine days. ***P < 0.001 compared with the morphine group; n = 6 per group. F-G, Western blot results (F) and immunofluorescence images (G) showing that amiloride prevented the upregulation of ASIC3 caused by morphine in the spinal cord. ***P < 0.001 compared with the saline group, #P < 0.05, ##P < 0.01 and ###P < 0.001 compared with the morphine group; n = 3 per group. Scale bar 20 μm. Abbreviations: Mor = morphine and Ami = amiloride.

Journal: European journal of pharmacology

Article Title: Amiloride alleviates morphine tolerance by suppressing ASIC3-dependent neuroinflammation in the spinal cord.

doi: 10.1016/j.ejphar.2023.176173

Figure Lengend Snippet: Fig. 3. Amiloride effects on morphine-induced antinociception tolerance and ASIC3 expression. A Graphical depiction of the treatment protocol. B–C, Amiloride alleviates chronic morphine tolerance. The hot plate test (B) and tail-flick test (C) were conducted on Days 1, 3, 5, 7, and 9. ***P < 0.001 compared with the morphine group; n = 6 per group. D-E, The area under the curve (AUC) for the %MPE of hot plate latency (D) and tail flick latency (E) was calculated over nine days. ***P < 0.001 compared with the morphine group; n = 6 per group. F-G, Western blot results (F) and immunofluorescence images (G) showing that amiloride prevented the upregulation of ASIC3 caused by morphine in the spinal cord. ***P < 0.001 compared with the saline group, #P < 0.05, ##P < 0.01 and ###P < 0.001 compared with the morphine group; n = 3 per group. Scale bar 20 μm. Abbreviations: Mor = morphine and Ami = amiloride.

Article Snippet: Antibodies against Asic2 (A04055-1) and Asic3 (BA2745-2) were purchased from Boster Biotechnology (California, USA).

Techniques: Expressing, Hot Plate Test, Tail Flick Test, Western Blot, Immunofluorescence, Saline

Fig. 4. APETx2 effects on morphine-induced antinociception tolerance and ASIC3 expression. A. Graphical depiction of the treatment protocol. B–C, APETx2 alleviates chronic morphine tolerance. The hot plate test (B) and tail-flick test (C) were conducted on Days 1, 3, 5, 7, and 9. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with the morphine group; n = 8 per group. D-E, The area under the curve (AUC) for the %MPE of hot plate latency (D) and tail flick latency (E) was calculated over nine days. *P < 0.05 and **P < 0.01 compared with the morphine group; n = 8 per group. F-G, Western blot results (F) and immunofluorescence images (G) showing that APETx2 prevented the upregulation of ASIC3 caused by morphine in the spinal cord. ***P < 0.001 compared with the saline group, #P < 0.05 and ###P < 0.001 compared with the morphine group; n = 3 per group. Scale bar 20 μm. Abbreviations: Mor = morphine and APE = APETx2.

Journal: European journal of pharmacology

Article Title: Amiloride alleviates morphine tolerance by suppressing ASIC3-dependent neuroinflammation in the spinal cord.

doi: 10.1016/j.ejphar.2023.176173

Figure Lengend Snippet: Fig. 4. APETx2 effects on morphine-induced antinociception tolerance and ASIC3 expression. A. Graphical depiction of the treatment protocol. B–C, APETx2 alleviates chronic morphine tolerance. The hot plate test (B) and tail-flick test (C) were conducted on Days 1, 3, 5, 7, and 9. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with the morphine group; n = 8 per group. D-E, The area under the curve (AUC) for the %MPE of hot plate latency (D) and tail flick latency (E) was calculated over nine days. *P < 0.05 and **P < 0.01 compared with the morphine group; n = 8 per group. F-G, Western blot results (F) and immunofluorescence images (G) showing that APETx2 prevented the upregulation of ASIC3 caused by morphine in the spinal cord. ***P < 0.001 compared with the saline group, #P < 0.05 and ###P < 0.001 compared with the morphine group; n = 3 per group. Scale bar 20 μm. Abbreviations: Mor = morphine and APE = APETx2.

Article Snippet: Antibodies against Asic2 (A04055-1) and Asic3 (BA2745-2) were purchased from Boster Biotechnology (California, USA).

Techniques: Expressing, Hot Plate Test, Tail Flick Test, Western Blot, Immunofluorescence, Saline

Fig. 6. In BV-2 cells, amiloride reduces morphine-induced inflammatory responses in an ASIC3-dependent manner. A-B. Real-time PCR showed that ami loride decreased the mRNA levels of IL-1β (A) and TNF-α (B) in BV-2 cells stimulated with morphine. C-D. Amiloride’s anti-inflammatory effects on IL-1β (C) and TNF-α (D) mRNA in BV-2 cells were sufficiently reduced by overexpression of ASIC3. E. Amiloride inhibited ASIC3 expression in morphine-stimulated BV-2 cells. F. Amiloride’s effect on p38 MAPK phosphorylation in morphine-stimulated BV-2 cells. G-H. BV-2 cells were transfected with 2.5 μg oeASIC3 or vector for 48 h, followed by coculture with morphine (200 μM) with or without amiloride (10 μM) for 12 h. The immunoblot assay was used to determine the efficacy of ASIC3 overexpression. (A–H The data came from three separate experiments). I. Amiloride (10 μM) decreased NF–B translocation from the cytoplasm to the nucleus in BV-2 cells following a 4-h morphine (200 μM) treatment (n = 4). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. the vehicle group; #P < 0.05 and ###P < 0.001 vs. the morphine-treated group or amiloride-treated group; &&&P < 0.001 vs. the morphine and amiloride-cotreatment group. Scale bar 10 μm. Abbreviations: Mor = morphine and Ami = amiloride.

Journal: European journal of pharmacology

Article Title: Amiloride alleviates morphine tolerance by suppressing ASIC3-dependent neuroinflammation in the spinal cord.

doi: 10.1016/j.ejphar.2023.176173

Figure Lengend Snippet: Fig. 6. In BV-2 cells, amiloride reduces morphine-induced inflammatory responses in an ASIC3-dependent manner. A-B. Real-time PCR showed that ami loride decreased the mRNA levels of IL-1β (A) and TNF-α (B) in BV-2 cells stimulated with morphine. C-D. Amiloride’s anti-inflammatory effects on IL-1β (C) and TNF-α (D) mRNA in BV-2 cells were sufficiently reduced by overexpression of ASIC3. E. Amiloride inhibited ASIC3 expression in morphine-stimulated BV-2 cells. F. Amiloride’s effect on p38 MAPK phosphorylation in morphine-stimulated BV-2 cells. G-H. BV-2 cells were transfected with 2.5 μg oeASIC3 or vector for 48 h, followed by coculture with morphine (200 μM) with or without amiloride (10 μM) for 12 h. The immunoblot assay was used to determine the efficacy of ASIC3 overexpression. (A–H The data came from three separate experiments). I. Amiloride (10 μM) decreased NF–B translocation from the cytoplasm to the nucleus in BV-2 cells following a 4-h morphine (200 μM) treatment (n = 4). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. the vehicle group; #P < 0.05 and ###P < 0.001 vs. the morphine-treated group or amiloride-treated group; &&&P < 0.001 vs. the morphine and amiloride-cotreatment group. Scale bar 10 μm. Abbreviations: Mor = morphine and Ami = amiloride.

Article Snippet: Antibodies against Asic2 (A04055-1) and Asic3 (BA2745-2) were purchased from Boster Biotechnology (California, USA).

Techniques: Real-time Polymerase Chain Reaction, Over Expression, Expressing, Phospho-proteomics, Transfection, Plasmid Preparation, Western Blot, Translocation Assay

Fig. 7. The schematic model indicates that ASIC3-dependent neuroinflammation suppression by amiloride potentiates morphine tolerance. Morphine activates microglia and increases the production of proinflammatory cytokines such as IL-1β and TNF-α through the p38/NF-κB pathway. Amiloride suppresses microglial activation and improves morphine tolerance by downregulating ASIC3 in the spinal cord.

Journal: European journal of pharmacology

Article Title: Amiloride alleviates morphine tolerance by suppressing ASIC3-dependent neuroinflammation in the spinal cord.

doi: 10.1016/j.ejphar.2023.176173

Figure Lengend Snippet: Fig. 7. The schematic model indicates that ASIC3-dependent neuroinflammation suppression by amiloride potentiates morphine tolerance. Morphine activates microglia and increases the production of proinflammatory cytokines such as IL-1β and TNF-α through the p38/NF-κB pathway. Amiloride suppresses microglial activation and improves morphine tolerance by downregulating ASIC3 in the spinal cord.

Article Snippet: Antibodies against Asic2 (A04055-1) and Asic3 (BA2745-2) were purchased from Boster Biotechnology (California, USA).

Techniques: Activation Assay

TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques: Gene Expression, Amplification

Primary antibodies, species, titer, and source.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Primary antibodies, species, titer, and source.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques:

qPCR detection of α, β, γENaC, and ASIC1‐5 transcript expression in cultured bone marrow derived macrophages and freshly isolated monocytes from male and female mice. Macrophages were cultured in the presence of 20 ng/mL of CSF1. (a) PCR reactions from macrophages were separated on 3%–4% agarose gels to determine if amplicon of expected size was present (identified by arrowhead in samples with >1 product). 100 ng RNA template equivalent was used for all reactions except ASIC1, where 1000 ng was used. Three primer pair‐probe sets were tested on ASIC2 and ASIC1. The primer pair‐probe sets shown amplified a band at the expected size, in addition to 1–2 other bands. (b) Macrophage C th 's individual ENaC and ASIC transcripts from bone marrow derived macrophages 3 replicates in n = 2 trials. Thresholds at or near 35 cycles were consistently identified in all replicates for αENaC and ASIC3. Thresholds less than 39 cycles were identified for βENaC and ASIC2. γENaC amplified in only 1/6 and 4/6 replicates in male and female samples, respectively. (c) Bone marrow derived freshly isolated monocytes C th 's for individual ENaC and ASIC subunits using 75 ng RNA template equivalent. Samples from four animals were pooled. (d) Bone marrow derived freshly isolated monocyte Western blot detection of αENaC and βENaC. Samples were pooled from four animals. *Indicates statistical difference between male and female at p < 0.05 using an Uncorrected Fisher LSD Test.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: qPCR detection of α, β, γENaC, and ASIC1‐5 transcript expression in cultured bone marrow derived macrophages and freshly isolated monocytes from male and female mice. Macrophages were cultured in the presence of 20 ng/mL of CSF1. (a) PCR reactions from macrophages were separated on 3%–4% agarose gels to determine if amplicon of expected size was present (identified by arrowhead in samples with >1 product). 100 ng RNA template equivalent was used for all reactions except ASIC1, where 1000 ng was used. Three primer pair‐probe sets were tested on ASIC2 and ASIC1. The primer pair‐probe sets shown amplified a band at the expected size, in addition to 1–2 other bands. (b) Macrophage C th 's individual ENaC and ASIC transcripts from bone marrow derived macrophages 3 replicates in n = 2 trials. Thresholds at or near 35 cycles were consistently identified in all replicates for αENaC and ASIC3. Thresholds less than 39 cycles were identified for βENaC and ASIC2. γENaC amplified in only 1/6 and 4/6 replicates in male and female samples, respectively. (c) Bone marrow derived freshly isolated monocytes C th 's for individual ENaC and ASIC subunits using 75 ng RNA template equivalent. Samples from four animals were pooled. (d) Bone marrow derived freshly isolated monocyte Western blot detection of αENaC and βENaC. Samples were pooled from four animals. *Indicates statistical difference between male and female at p < 0.05 using an Uncorrected Fisher LSD Test.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques: Expressing, Cell Culture, Derivative Assay, Isolation, Amplification, Western Blot

Loss of βENaC or ASIC2 inhibits bone marrow monocyte chemotactic migration. Chemotactic migration is attenuated in freshly isolated bone marrow monocytes from (a, b) βENaC hypomorph mice (βENaC m/m , 10–13 weeks of age) or (c, d) ASIC2 global knockout mice (ASIC2 −/− , 7–8 weeks of age). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Mice were used between 7 and 13 weeks of age. These findings suggest (1) migration responses in wildtype mice are greater in female versus males, and (2) βENaC and ASIC2 both contribute to migration, but differentially in the sexes. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. Normalized migration data are shown in Figure Representative images are shown in panels a and c and group data are shown in panels b and d. Data are mean ± SEM and represent seven FOVs from three insets ( n = 21) and were analyzed using two‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Loss of βENaC or ASIC2 inhibits bone marrow monocyte chemotactic migration. Chemotactic migration is attenuated in freshly isolated bone marrow monocytes from (a, b) βENaC hypomorph mice (βENaC m/m , 10–13 weeks of age) or (c, d) ASIC2 global knockout mice (ASIC2 −/− , 7–8 weeks of age). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Mice were used between 7 and 13 weeks of age. These findings suggest (1) migration responses in wildtype mice are greater in female versus males, and (2) βENaC and ASIC2 both contribute to migration, but differentially in the sexes. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. Normalized migration data are shown in Figure Representative images are shown in panels a and c and group data are shown in panels b and d. Data are mean ± SEM and represent seven FOVs from three insets ( n = 21) and were analyzed using two‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques: Migration, Isolation, Knock-Out, Modification

Loss of ASIC2 plus βENaC on bone marrow monocyte chemotactic migration is not additive. Chemotactic migration in freshly isolated bone marrow from mice homozygous for ASIC2 global knockout and βENaC hypomorph alleles (ASIC2 −/− /βENaC m/m , 6–7 weeks). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Representative images of underside of migration membrane (a) and group data (b) in males are shown. These findings suggest (1) migration responses in wildtype mice are greater in female versus male, and (2) βENaC plus ASIC2 both contribute to migration, but greater impact on female. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. (c). Normalized migration data in monocytes from βENaC m/m , ASIC2 −/− , and ASIC2 −/− /βENaC m/m mice are shown. Both data sets are presented as mean ± SEM and represent seven FOVs from three insets ( n = 21, except wildtype control in C where n = 21 FOVs from n = 9 inserts) and were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Loss of ASIC2 plus βENaC on bone marrow monocyte chemotactic migration is not additive. Chemotactic migration in freshly isolated bone marrow from mice homozygous for ASIC2 global knockout and βENaC hypomorph alleles (ASIC2 −/− /βENaC m/m , 6–7 weeks). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Representative images of underside of migration membrane (a) and group data (b) in males are shown. These findings suggest (1) migration responses in wildtype mice are greater in female versus male, and (2) βENaC plus ASIC2 both contribute to migration, but greater impact on female. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. (c). Normalized migration data in monocytes from βENaC m/m , ASIC2 −/− , and ASIC2 −/− /βENaC m/m mice are shown. Both data sets are presented as mean ± SEM and represent seven FOVs from three insets ( n = 21, except wildtype control in C where n = 21 FOVs from n = 9 inserts) and were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques: Migration, Isolation, Knock-Out, Modification, Membrane, Control

Bone marrow macrophages from mice lacking ASIC2 plus βENaC (ASIC2 −/− /βENaC m/m , KO) are polarized towards an M1 phenotype. (a) Migration of bone marrow derived macrophages from ASIC2 −/− /βENaC m/m mice are inhibited to 55% and 65% of WT control cells from females and males, respectively. Data were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. (b) Fold expression of monocyte/macrophage marker message in cultured bone marrow macrophages from males. The myeloid origin marker CD68 was decreased and M1 macrophage marker CD86 was upregulated in KO cells. The M2 marker CD206 was not significantly elevated. CD163, another marker of M2 macrophages, did not amplify in any samples. (c) Media soluble TNFα, released from M1 macrophages, was elevated in KO cell culture media. Samples were obtained from two wells from three different cell lines. Data in Panels b and d were analyzed using independent/unpaired, 2‐tailed t ‐tests. Representative images (d) and group data (e) from semiquantitative immunolabeling of CD86 and CD206 in cells show CD86, but not CD206, are elevated in KO cells. each data point represents a cluster of cells, n = 5–6 cell clusters from n = 3 images. Fluorescence is normalized to cell area. Data in panels e and f analyzed using 1‐way ANOVA followed by the Holm‐Sidak post hoc test. These findings suggest bone marrow macrophages from mice lacking βENaC and ASIC2 are polarized towards the M1 phenotype. All data are mean ± SEM. P values are provided to demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Bone marrow macrophages from mice lacking ASIC2 plus βENaC (ASIC2 −/− /βENaC m/m , KO) are polarized towards an M1 phenotype. (a) Migration of bone marrow derived macrophages from ASIC2 −/− /βENaC m/m mice are inhibited to 55% and 65% of WT control cells from females and males, respectively. Data were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. (b) Fold expression of monocyte/macrophage marker message in cultured bone marrow macrophages from males. The myeloid origin marker CD68 was decreased and M1 macrophage marker CD86 was upregulated in KO cells. The M2 marker CD206 was not significantly elevated. CD163, another marker of M2 macrophages, did not amplify in any samples. (c) Media soluble TNFα, released from M1 macrophages, was elevated in KO cell culture media. Samples were obtained from two wells from three different cell lines. Data in Panels b and d were analyzed using independent/unpaired, 2‐tailed t ‐tests. Representative images (d) and group data (e) from semiquantitative immunolabeling of CD86 and CD206 in cells show CD86, but not CD206, are elevated in KO cells. each data point represents a cluster of cells, n = 5–6 cell clusters from n = 3 images. Fluorescence is normalized to cell area. Data in panels e and f analyzed using 1‐way ANOVA followed by the Holm‐Sidak post hoc test. These findings suggest bone marrow macrophages from mice lacking βENaC and ASIC2 are polarized towards the M1 phenotype. All data are mean ± SEM. P values are provided to demonstrate confidence.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques: Migration, Derivative Assay, Control, Expressing, Marker, Cell Culture, Immunolabeling, Fluorescence

Does rescue of ASIC2 or βENaC in bone marrow macrophages from ASIC2 −/− /βENaC m/m mice restore the chemotactic migration response and polarization marker expression? ASIC2 −/− /βENaC m/m (KO) male cell lines were transfected with ECFP_mouse ASIC2 or EGFP_mouse βENaC full length constructs and maintained in the presence of selection antibiotic G418 (except WT control and KO control). (a) Rescue of either ASIC2 or βENaC partially rescues the chemotactic migration response in macrophages lacking ASIC2 and βENaC. Migration data points represent 42–63 FOVs from n = 2 to 3 inserts from three trials. (b) The monocyte origin marker CD68 (b) increased with rescue of ASIC2a and M1 macrophage marker CD86 decreased (c, d), consistent with the decrease in CD68 and increase in CD86 in KO versus WT macrophages (Figure ). The C Th for GAPDH, CD68, and CD86 in KO‐EGFP control samples are within range to detect increases or decreases (20, 20, and 32, respectively). CD163 were not consistently detected in the three replicates from 2 to 5 independent trials. (d). Immunolabeling of CD86‐Viobright 515 in KO macrophages rescued with βENaC or ASIC2 are consistent with qPCR findings. Fluorescence signal of CD86 was greater than baseline EGFP/ECFP signal assessed in separate samples (not shown). (e) Soluble TNFα in the media of cultured macrophages (72 h) was decreased in βENaC, but increased in ASIC2 rescued macrophages. All data are mean ± SEM. Migration data were analyzed using 1‐way ANOVA followed by Holm‐Sidak post hoc test. Quantitative PCR were analyzed using a 1‐way ANOVA followed by Dunnett post hoc test. p values are provided to demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Does rescue of ASIC2 or βENaC in bone marrow macrophages from ASIC2 −/− /βENaC m/m mice restore the chemotactic migration response and polarization marker expression? ASIC2 −/− /βENaC m/m (KO) male cell lines were transfected with ECFP_mouse ASIC2 or EGFP_mouse βENaC full length constructs and maintained in the presence of selection antibiotic G418 (except WT control and KO control). (a) Rescue of either ASIC2 or βENaC partially rescues the chemotactic migration response in macrophages lacking ASIC2 and βENaC. Migration data points represent 42–63 FOVs from n = 2 to 3 inserts from three trials. (b) The monocyte origin marker CD68 (b) increased with rescue of ASIC2a and M1 macrophage marker CD86 decreased (c, d), consistent with the decrease in CD68 and increase in CD86 in KO versus WT macrophages (Figure ). The C Th for GAPDH, CD68, and CD86 in KO‐EGFP control samples are within range to detect increases or decreases (20, 20, and 32, respectively). CD163 were not consistently detected in the three replicates from 2 to 5 independent trials. (d). Immunolabeling of CD86‐Viobright 515 in KO macrophages rescued with βENaC or ASIC2 are consistent with qPCR findings. Fluorescence signal of CD86 was greater than baseline EGFP/ECFP signal assessed in separate samples (not shown). (e) Soluble TNFα in the media of cultured macrophages (72 h) was decreased in βENaC, but increased in ASIC2 rescued macrophages. All data are mean ± SEM. Migration data were analyzed using 1‐way ANOVA followed by Holm‐Sidak post hoc test. Quantitative PCR were analyzed using a 1‐way ANOVA followed by Dunnett post hoc test. p values are provided to demonstrate confidence.

Article Snippet: ASIC2b , NM_007384.3 , Mm00475687_m1 , 1–2 , 105.

Techniques: Migration, Marker, Expressing, Transfection, Construct, Selection, Control, Immunolabeling, Fluorescence, Cell Culture, Real-time Polymerase Chain Reaction

TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: TaqMan Gene Expression Assay Primer‐Probe Pairs for mouse ENaC Subunits.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques: Gene Expression, Amplification

Primary antibodies, species, titer, and source.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Primary antibodies, species, titer, and source.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques:

qPCR detection of α, β, γENaC, and ASIC1‐5 transcript expression in cultured bone marrow derived macrophages and freshly isolated monocytes from male and female mice. Macrophages were cultured in the presence of 20 ng/mL of CSF1. (a) PCR reactions from macrophages were separated on 3%–4% agarose gels to determine if amplicon of expected size was present (identified by arrowhead in samples with >1 product). 100 ng RNA template equivalent was used for all reactions except ASIC1, where 1000 ng was used. Three primer pair‐probe sets were tested on ASIC2 and ASIC1. The primer pair‐probe sets shown amplified a band at the expected size, in addition to 1–2 other bands. (b) Macrophage C th 's individual ENaC and ASIC transcripts from bone marrow derived macrophages 3 replicates in n = 2 trials. Thresholds at or near 35 cycles were consistently identified in all replicates for αENaC and ASIC3. Thresholds less than 39 cycles were identified for βENaC and ASIC2. γENaC amplified in only 1/6 and 4/6 replicates in male and female samples, respectively. (c) Bone marrow derived freshly isolated monocytes C th 's for individual ENaC and ASIC subunits using 75 ng RNA template equivalent. Samples from four animals were pooled. (d) Bone marrow derived freshly isolated monocyte Western blot detection of αENaC and βENaC. Samples were pooled from four animals. *Indicates statistical difference between male and female at p < 0.05 using an Uncorrected Fisher LSD Test.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: qPCR detection of α, β, γENaC, and ASIC1‐5 transcript expression in cultured bone marrow derived macrophages and freshly isolated monocytes from male and female mice. Macrophages were cultured in the presence of 20 ng/mL of CSF1. (a) PCR reactions from macrophages were separated on 3%–4% agarose gels to determine if amplicon of expected size was present (identified by arrowhead in samples with >1 product). 100 ng RNA template equivalent was used for all reactions except ASIC1, where 1000 ng was used. Three primer pair‐probe sets were tested on ASIC2 and ASIC1. The primer pair‐probe sets shown amplified a band at the expected size, in addition to 1–2 other bands. (b) Macrophage C th 's individual ENaC and ASIC transcripts from bone marrow derived macrophages 3 replicates in n = 2 trials. Thresholds at or near 35 cycles were consistently identified in all replicates for αENaC and ASIC3. Thresholds less than 39 cycles were identified for βENaC and ASIC2. γENaC amplified in only 1/6 and 4/6 replicates in male and female samples, respectively. (c) Bone marrow derived freshly isolated monocytes C th 's for individual ENaC and ASIC subunits using 75 ng RNA template equivalent. Samples from four animals were pooled. (d) Bone marrow derived freshly isolated monocyte Western blot detection of αENaC and βENaC. Samples were pooled from four animals. *Indicates statistical difference between male and female at p < 0.05 using an Uncorrected Fisher LSD Test.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques: Expressing, Cell Culture, Derivative Assay, Isolation, Amplification, Western Blot

Loss of βENaC or ASIC2 inhibits bone marrow monocyte chemotactic migration. Chemotactic migration is attenuated in freshly isolated bone marrow monocytes from (a, b) βENaC hypomorph mice (βENaC m/m , 10–13 weeks of age) or (c, d) ASIC2 global knockout mice (ASIC2 −/− , 7–8 weeks of age). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Mice were used between 7 and 13 weeks of age. These findings suggest (1) migration responses in wildtype mice are greater in female versus males, and (2) βENaC and ASIC2 both contribute to migration, but differentially in the sexes. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. Normalized migration data are shown in Figure Representative images are shown in panels a and c and group data are shown in panels b and d. Data are mean ± SEM and represent seven FOVs from three insets ( n = 21) and were analyzed using two‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Loss of βENaC or ASIC2 inhibits bone marrow monocyte chemotactic migration. Chemotactic migration is attenuated in freshly isolated bone marrow monocytes from (a, b) βENaC hypomorph mice (βENaC m/m , 10–13 weeks of age) or (c, d) ASIC2 global knockout mice (ASIC2 −/− , 7–8 weeks of age). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Mice were used between 7 and 13 weeks of age. These findings suggest (1) migration responses in wildtype mice are greater in female versus males, and (2) βENaC and ASIC2 both contribute to migration, but differentially in the sexes. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. Normalized migration data are shown in Figure Representative images are shown in panels a and c and group data are shown in panels b and d. Data are mean ± SEM and represent seven FOVs from three insets ( n = 21) and were analyzed using two‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques: Migration, Isolation, Knock-Out, Modification

Loss of ASIC2 plus βENaC on bone marrow monocyte chemotactic migration is not additive. Chemotactic migration in freshly isolated bone marrow from mice homozygous for ASIC2 global knockout and βENaC hypomorph alleles (ASIC2 −/− /βENaC m/m , 6–7 weeks). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Representative images of underside of migration membrane (a) and group data (b) in males are shown. These findings suggest (1) migration responses in wildtype mice are greater in female versus male, and (2) βENaC plus ASIC2 both contribute to migration, but greater impact on female. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. (c). Normalized migration data in monocytes from βENaC m/m , ASIC2 −/− , and ASIC2 −/− /βENaC m/m mice are shown. Both data sets are presented as mean ± SEM and represent seven FOVs from three insets ( n = 21, except wildtype control in C where n = 21 FOVs from n = 9 inserts) and were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Loss of ASIC2 plus βENaC on bone marrow monocyte chemotactic migration is not additive. Chemotactic migration in freshly isolated bone marrow from mice homozygous for ASIC2 global knockout and βENaC hypomorph alleles (ASIC2 −/− /βENaC m/m , 6–7 weeks). Monocytes were isolated in parallel from an age‐matched wildtype and modified animal within a sex then migrated overnight. Representative images of underside of migration membrane (a) and group data (b) in males are shown. These findings suggest (1) migration responses in wildtype mice are greater in female versus male, and (2) βENaC plus ASIC2 both contribute to migration, but greater impact on female. Loss of βENaC had a larger impact on migration in female versus male, while loss of ASIC2 had a larger impact in males. (c). Normalized migration data in monocytes from βENaC m/m , ASIC2 −/− , and ASIC2 −/− /βENaC m/m mice are shown. Both data sets are presented as mean ± SEM and represent seven FOVs from three insets ( n = 21, except wildtype control in C where n = 21 FOVs from n = 9 inserts) and were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. p values of main factors and their interaction and differences among groups are shown on the graph and demonstrate confidence.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques: Migration, Isolation, Knock-Out, Modification, Membrane, Control

Bone marrow macrophages from mice lacking ASIC2 plus βENaC (ASIC2 −/− /βENaC m/m , KO) are polarized towards an M1 phenotype. (a) Migration of bone marrow derived macrophages from ASIC2 −/− /βENaC m/m mice are inhibited to 55% and 65% of WT control cells from females and males, respectively. Data were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. (b) Fold expression of monocyte/macrophage marker message in cultured bone marrow macrophages from males. The myeloid origin marker CD68 was decreased and M1 macrophage marker CD86 was upregulated in KO cells. The M2 marker CD206 was not significantly elevated. CD163, another marker of M2 macrophages, did not amplify in any samples. (c) Media soluble TNFα, released from M1 macrophages, was elevated in KO cell culture media. Samples were obtained from two wells from three different cell lines. Data in Panels b and d were analyzed using independent/unpaired, 2‐tailed t ‐tests. Representative images (d) and group data (e) from semiquantitative immunolabeling of CD86 and CD206 in cells show CD86, but not CD206, are elevated in KO cells. each data point represents a cluster of cells, n = 5–6 cell clusters from n = 3 images. Fluorescence is normalized to cell area. Data in panels e and f analyzed using 1‐way ANOVA followed by the Holm‐Sidak post hoc test. These findings suggest bone marrow macrophages from mice lacking βENaC and ASIC2 are polarized towards the M1 phenotype. All data are mean ± SEM. P values are provided to demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Bone marrow macrophages from mice lacking ASIC2 plus βENaC (ASIC2 −/− /βENaC m/m , KO) are polarized towards an M1 phenotype. (a) Migration of bone marrow derived macrophages from ASIC2 −/− /βENaC m/m mice are inhibited to 55% and 65% of WT control cells from females and males, respectively. Data were analyzed using 2‐way ANOVA followed by Holm‐Sidak post hoc test. (b) Fold expression of monocyte/macrophage marker message in cultured bone marrow macrophages from males. The myeloid origin marker CD68 was decreased and M1 macrophage marker CD86 was upregulated in KO cells. The M2 marker CD206 was not significantly elevated. CD163, another marker of M2 macrophages, did not amplify in any samples. (c) Media soluble TNFα, released from M1 macrophages, was elevated in KO cell culture media. Samples were obtained from two wells from three different cell lines. Data in Panels b and d were analyzed using independent/unpaired, 2‐tailed t ‐tests. Representative images (d) and group data (e) from semiquantitative immunolabeling of CD86 and CD206 in cells show CD86, but not CD206, are elevated in KO cells. each data point represents a cluster of cells, n = 5–6 cell clusters from n = 3 images. Fluorescence is normalized to cell area. Data in panels e and f analyzed using 1‐way ANOVA followed by the Holm‐Sidak post hoc test. These findings suggest bone marrow macrophages from mice lacking βENaC and ASIC2 are polarized towards the M1 phenotype. All data are mean ± SEM. P values are provided to demonstrate confidence.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques: Migration, Derivative Assay, Control, Expressing, Marker, Cell Culture, Immunolabeling, Fluorescence

Does rescue of ASIC2 or βENaC in bone marrow macrophages from ASIC2 −/− /βENaC m/m mice restore the chemotactic migration response and polarization marker expression? ASIC2 −/− /βENaC m/m (KO) male cell lines were transfected with ECFP_mouse ASIC2 or EGFP_mouse βENaC full length constructs and maintained in the presence of selection antibiotic G418 (except WT control and KO control). (a) Rescue of either ASIC2 or βENaC partially rescues the chemotactic migration response in macrophages lacking ASIC2 and βENaC. Migration data points represent 42–63 FOVs from n = 2 to 3 inserts from three trials. (b) The monocyte origin marker CD68 (b) increased with rescue of ASIC2a and M1 macrophage marker CD86 decreased (c, d), consistent with the decrease in CD68 and increase in CD86 in KO versus WT macrophages (Figure ). The C Th for GAPDH, CD68, and CD86 in KO‐EGFP control samples are within range to detect increases or decreases (20, 20, and 32, respectively). CD163 were not consistently detected in the three replicates from 2 to 5 independent trials. (d). Immunolabeling of CD86‐Viobright 515 in KO macrophages rescued with βENaC or ASIC2 are consistent with qPCR findings. Fluorescence signal of CD86 was greater than baseline EGFP/ECFP signal assessed in separate samples (not shown). (e) Soluble TNFα in the media of cultured macrophages (72 h) was decreased in βENaC, but increased in ASIC2 rescued macrophages. All data are mean ± SEM. Migration data were analyzed using 1‐way ANOVA followed by Holm‐Sidak post hoc test. Quantitative PCR were analyzed using a 1‐way ANOVA followed by Dunnett post hoc test. p values are provided to demonstrate confidence.

Journal: Physiological Reports

Article Title: Bone marrow monocytes and macrophages from mice lacking βENaC and ASIC2 have a reduced chemotactic migration response and polarization

doi: 10.14814/phy2.16139

Figure Lengend Snippet: Does rescue of ASIC2 or βENaC in bone marrow macrophages from ASIC2 −/− /βENaC m/m mice restore the chemotactic migration response and polarization marker expression? ASIC2 −/− /βENaC m/m (KO) male cell lines were transfected with ECFP_mouse ASIC2 or EGFP_mouse βENaC full length constructs and maintained in the presence of selection antibiotic G418 (except WT control and KO control). (a) Rescue of either ASIC2 or βENaC partially rescues the chemotactic migration response in macrophages lacking ASIC2 and βENaC. Migration data points represent 42–63 FOVs from n = 2 to 3 inserts from three trials. (b) The monocyte origin marker CD68 (b) increased with rescue of ASIC2a and M1 macrophage marker CD86 decreased (c, d), consistent with the decrease in CD68 and increase in CD86 in KO versus WT macrophages (Figure ). The C Th for GAPDH, CD68, and CD86 in KO‐EGFP control samples are within range to detect increases or decreases (20, 20, and 32, respectively). CD163 were not consistently detected in the three replicates from 2 to 5 independent trials. (d). Immunolabeling of CD86‐Viobright 515 in KO macrophages rescued with βENaC or ASIC2 are consistent with qPCR findings. Fluorescence signal of CD86 was greater than baseline EGFP/ECFP signal assessed in separate samples (not shown). (e) Soluble TNFα in the media of cultured macrophages (72 h) was decreased in βENaC, but increased in ASIC2 rescued macrophages. All data are mean ± SEM. Migration data were analyzed using 1‐way ANOVA followed by Holm‐Sidak post hoc test. Quantitative PCR were analyzed using a 1‐way ANOVA followed by Dunnett post hoc test. p values are provided to demonstrate confidence.

Article Snippet: ACCN1 , ASIC2 , NM_001034013.2 , Mm01304218_m1 , 8–9 , 99.

Techniques: Migration, Marker, Expressing, Transfection, Construct, Selection, Control, Immunolabeling, Fluorescence, Cell Culture, Real-time Polymerase Chain Reaction