Journal: Frontiers in Oncology

Article Title: Identification of Glycolysis-Related lncRNAs and the Novel lncRNA WAC-AS1 Promotes Glycolysis and Tumor Progression in Hepatocellular Carcinoma

doi: 10.3389/fonc.2021.733595

Figure Lengend Snippet: WAC-AS1 regulated ARPP19 by sponging miR-320d. (A) venn diagram showing the predicted target genes of WAC-AS1 from databases (miRDB, ENCORI, and starBase); (B) screening out target genes with differences analysis; (C) venn diagram showing the predicted target genes of miR-320d; (D) the correlation analysis between WAC-AS1 and ARPP19 using data from TCGA database; (E) the wild-type and the mutated sequences of the ARPP19 mRNA 3’-UTR (mutation site: red); (F) the levels of miR-320d after miR-320d mimics and miR-320d inhibitor were transfected; (G) expression of the ARPP19 after treated with miR-320d mimics or inhibitor; (H) the luciferase activity in luciferase reporter plasmid containing wild-type ARPP19 and mutated ARPP19 co-transfected with miR-320d mimics or negative control; (I) the wild-type and the mutated sequences of the WAC-AS1; (J) the luciferase activity in luciferase reporter plasmid containing wild-type WAC-AS1 and mutated WAC-AS1 co-transfected with miR-320d mimics or negative control; (K) the protein levels of ARPP19 were regulated by WAC-AS1 and miR-320d; (L) ARPP19 expression in differentially treated cells; (M) glucose uptake in Hep3B and HCCLM3 cells; (N) lactate production detected by the lactate assay kit. ∗∗P < 0.01; ***p < 0.001.

Article Snippet: Anti-LDHA antibody (21799-1-AP), anti-TPI1 antibody (10713-1-AP), anti-ARPP19 antibody (11678-1-AP), anti-KIF2A antibody (13105-1-AP) and anti-beta actin antibody (66009-1-Ig) were purchased from Proteintech (Wuhan, China).

Techniques: Mutagenesis, Transfection, Expressing, Luciferase, Activity Assay, Plasmid Preparation, Negative Control, Lactate Assay

Journal: Cancer Cell International

Article Title: LncRNA XIST from the bone marrow mesenchymal stem cell derived exosome promotes osteosarcoma growth and metastasis through miR-655/ACLY signal

doi: 10.1186/s12935-022-02746-0

Figure Lengend Snippet: BMSCs derived exosomal XIST regulated ACLY expression in osteosarcoma cells by binding miR-655. A Western blot analysis the effect of BMSCs derived exosomal XIST combined with miR-655 on the expression of ARPP19, TOB1 and ACLY in osteosarcoma cells (n = 3); B At animal level, western blot analysis the effect of BMSCs derived exosomal XIST combined with miR-655 on ACLY expression (n = 3); C The binding pattern of miR-655 and the ACLY 3'-UTR and the corresponding mutation information; D The binding of miR-655 and the ACLY 3'-UTR and their possible sites analyzed by dual luciferase reporter gene assay (n = 3). ** represents p < 0.01

Article Snippet: The PVDF membrane was incubated with primary antibodies diluted with blocking solution overnight at 4°C respectively (GAPDH, Abcam, ab8245; Lamin B1, Abcam, ab16048; β-catenin, Abcam, ab32572; CD9, Abcam, ab263019; CD63, Abcam, ab134045; CD81, Abcam, ab79559; calnexin, CST, 2679; ARPP19, Affinity, DF9325; TOB1, ProteintechGroup, Inc, 14915-1-AP; ACLY, Abcam, ab40793. the dilution ratio was 1:1000), and the corresponding HRP labeled secondary antibody (HRP labeled Sheep anti-mouse secondary antibody, Wuhan Boster Biological Technology., Ltd., BA1051; HRP labeled Sheep anti-rabbit secondary antibody, Wuhan Boster Biological Technology., Ltd., BA1054; the dilution ratio was 1:5000) was diluted with the blocking solution and the PVDF membrane was incubated at room temperature.

Techniques: Derivative Assay, Expressing, Binding Assay, Western Blot, Mutagenesis, Luciferase, Reporter Gene Assay

Journal: International Journal of Molecular Sciences

Article Title: IGFL2-AS1, a Long Non-Coding RNA, Is Associated with Radioresistance in Colorectal Cancer

doi: 10.3390/ijms24020978

Figure Lengend Snippet: AKT pathway signaling is suppressed by sh-IGFL2-AS1. ( A ) Schematic depicting the IGFL2-AS1 pathway. ( B ) Relative transcription of ARPP19, measured using qRT PCR. The graph depicts the levels of ARPP19 in the indicated cell lines. Data are normalized to those of the sh-NC-HT29 cell line; error bars indicate SDs. *** p < 0.001. ( C ) Protein expression of ARPP19, measured by western blotting. The expression of β-actin was used as a loading control. ( D ) Western blot analyses of various proteins downstream of AKT. Cells incubated as indicated after irradiation (3 Gy) were lysed and analyzed by western blotting; β-actin was used as a loading control. ( E – H ) Densitometric measurements of protein expressions, corresponding to ( D ). The results are presented as the ratio of phosphor-AKT/AKT ( E ), cyclin D1/β-actin ( F ), c-Myc/β-actin ( G ), and E-cadherin/β-actin ( H ).

Article Snippet: Primary antibodies against ARPP19 (#MBS9609642) were obtained from MyBioSource (San Diego, CA, USA); phospho-AKT (#4060) and AKT (#4691) were obtained from Cell Signaling Technology; c-Myc (#sc-764), cyclin D1 (#sc-753), E-cadherin (#sc-8426), and β-actin (#sc-47778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Quantitative RT-PCR, Expressing, Western Blot, Control, Incubation, Irradiation

Journal: International Journal of Molecular Sciences

Article Title: Increased ARPP-19 Expression Is Associated with Hepatocellular Carcinoma

doi: 10.3390/ijms16010178

Figure Lengend Snippet: Sketch of the activation of cyclin B-Cdc2 through an autoregulatory loop and the role of ARPP-19 during mitotic entry. The small starter amount of active cyclin B-Cdc2 inactivates Wee1/Myt1 and activates Cdc25 to further activate a larger population of cyclin B-Cdc2. PP2A is the phosphatase that antagonizes these effects of cyclin B-Cdc2. Full activation of Cdc2 cannot take place unless PP2A is inhibited. Gwl is activated by the threshold amount of Cdc2 activity. Gwl, in turn, activates ARPP-19, which binds and inhibits PP2A. ARPP-19 is reported to be also activated directly by Cdc2. The pathway in red denotes the role of ARPP-19.

Article Snippet: According to the siRNA sequence against human ARPP-19 (AAGCCTGGAGGTTCAGATTTCTTAA), the ARPP-19-RNAi lentiviral vector was constructed by GeneChem Co., Ltd. (Shanghai, China), using the vector, GV118-GFP.

Techniques: Activation Assay, Activity Assay

Journal: International Journal of Molecular Sciences

Article Title: Increased ARPP-19 Expression Is Associated with Hepatocellular Carcinoma

doi: 10.3390/ijms16010178

Figure Lengend Snippet: Expression of ARPP-19 in HCC. ( A ) ARPP-19 expression at the mRNA level in 36 pairs of HCC and corresponding non-tumorous liver tissues (NT) was examined by qRT-PCR, with the combination of TBP and SRSF as the internal reference genes ( n = 36, ** p < 0.01); ( B ) Representative western blots of ARPP-19 protein in HCC and non-tumorous liver tissues (NT) samples. β-actin served as a loading control; ( C ) Correlation of the ARPP-19 expression level with the maximal tumor size in HCC ( n = 36, r = 0.43, p < 0.01); ( D ) Quantification of ( B ) ( n = 10, * p < 0.05).

Article Snippet: According to the siRNA sequence against human ARPP-19 (AAGCCTGGAGGTTCAGATTTCTTAA), the ARPP-19-RNAi lentiviral vector was constructed by GeneChem Co., Ltd. (Shanghai, China), using the vector, GV118-GFP.

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: International Journal of Molecular Sciences

Article Title: Increased ARPP-19 Expression Is Associated with Hepatocellular Carcinoma

doi: 10.3390/ijms16010178

Figure Lengend Snippet: Down-regulating the expression of ARPP-19 in hepatocarcinoma cells. ( A ) The expression level of ARPP-19 in four strains of hepatocarcinoma cells and in the pool of ten pairs of HCC and the non-tumorous liver tissues (NT) was determined by qRT-PCR, with β-actin as the internal control; ( B ) HepG2 and SMMC-7721 cells were transfected with lentivirus with GV118-GFP vector carrying siRNA against ARPP-19 (ARPP-19-RNAi) or empty vector (scramble). The ARPP-19 mRNA level was measured by qRT-PCR, with β-actin as the internal control; ( C ) The protein level of ARPP-19 in HepG2 and SMMC-7721 cells transfected with ARPP-19-RNAi or scramble was measured by immunoblotting, with β-actin as the loading control; ( D ) The images of western blots of ( C ) were quantified. The data are shown as the mean ± SEM, and significant values are indicated with asterisks ( * p < 0.05; ** p < 0.01, versus scramble).

Article Snippet: According to the siRNA sequence against human ARPP-19 (AAGCCTGGAGGTTCAGATTTCTTAA), the ARPP-19-RNAi lentiviral vector was constructed by GeneChem Co., Ltd. (Shanghai, China), using the vector, GV118-GFP.

Techniques: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Western Blot

Journal: International Journal of Molecular Sciences

Article Title: Increased ARPP-19 Expression Is Associated with Hepatocellular Carcinoma

doi: 10.3390/ijms16010178

Figure Lengend Snippet: Down-regulated ARPP-19 inhibits the proliferation of hepatocarcinoma cells. ( A ) Cell proliferation was determined using the CCK8 assay. HepG2 or SMMC-7721 cells transfected with lentivirus with siRNA of ARPP-19 (ARPP-19 RNAi) or scramble were seeded into 96-well plates in triplicate. After culturing for 12, 24, 48, 72, 96 or 120 h, the medium was replaced with fresh medium with CCK-8 reagent, followed by 4 h of incubation. The OD value at 450 nm was measured; ( B ) HepG2 or SMMC-7721 cells were cultured in six-well plates for 72 h before being fixed and stained with DAPI. Ten separate fields were imaged under an inverted fluorescence microscope with a magnification of 200×; ( C ) The cell number in ( B ) was counted and analyzed; ( D ) Cells were cultured on soft agar in six-well plates. After 10 days, the formed cell clones containing over 50 cells were counted with the aid of a microscope. All data are shown as the mean ± SEM, and significant values are indicated with asterisks ( * p < 0.05; ** p < 0.01; *** p < 0.001, versus scramble).

Article Snippet: According to the siRNA sequence against human ARPP-19 (AAGCCTGGAGGTTCAGATTTCTTAA), the ARPP-19-RNAi lentiviral vector was constructed by GeneChem Co., Ltd. (Shanghai, China), using the vector, GV118-GFP.

Techniques: CCK-8 Assay, Transfection, Incubation, Cell Culture, Staining, Fluorescence, Microscopy, Clone Assay

Journal: International Journal of Molecular Sciences

Article Title: Increased ARPP-19 Expression Is Associated with Hepatocellular Carcinoma

doi: 10.3390/ijms16010178

Figure Lengend Snippet: Down-regulated ARPP-19 leads to G2/M cell cycle arrest in hepatocarcinoma cells. ( A ) FACS analysis of HepG2 cells. Cells were cultured for 72 h. All floating and attached cells were collected, stained with propidium iodide and subjected to FACS analysis to examine their cell cycle distributions; ( B ) The percentage of HepG2 cells in each phase of the cell cycle; ( C ) FACS analysis of SMMC-7721 cells; ( D ) The percentage of SMMC-7721 cells in each phase of the cell cycle. All data are shown as the mean ± SEM of three independent experiments, and significant values are indicated with asterisks ( * p < 0.05; ** p < 0.01, versus scramble).

Article Snippet: According to the siRNA sequence against human ARPP-19 (AAGCCTGGAGGTTCAGATTTCTTAA), the ARPP-19-RNAi lentiviral vector was constructed by GeneChem Co., Ltd. (Shanghai, China), using the vector, GV118-GFP.

Techniques: Cell Culture, Staining

Journal: International Journal of Molecular Sciences

Article Title: Increased ARPP-19 Expression Is Associated with Hepatocellular Carcinoma

doi: 10.3390/ijms16010178

Figure Lengend Snippet: Down-regulated ARPP-19 resulted in decreased phosphorylated mitotic substrates. ( A ) The protein levels of ARPP-19, cyclin A, cyclin D1, cyclin B1, Cdk2 and Cdk4 in HepG2 or SMMC-7721 cells were analyzed by western blot, with β-actin serving as an internal reference; ( B ) HepG2 or SMMC-7721 cells were synchronized at the M phase by thymidine and released into nocodazole for 16 h. The protein levels of ARPP-19, phospho-cdc2 (Tyr15) and the phosphorylation of the different cyclin B-Cdc2 substrates (phospho-(Ser) CDKs substrate) were analyzed by western blot, with β-actin serving as an internal reference; ( C ) Quantification of data in ( B ). All data are shown as the mean ± SEM of three independent experiments, and significant values are indicated with asterisks ( * p < 0.05; ** p < 0.01, versus scramble).

Article Snippet: According to the siRNA sequence against human ARPP-19 (AAGCCTGGAGGTTCAGATTTCTTAA), the ARPP-19-RNAi lentiviral vector was constructed by GeneChem Co., Ltd. (Shanghai, China), using the vector, GV118-GFP.

Techniques: Western Blot