Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) Western blot analysis of wild type SVG-A (WT) cells or two APMAP null clones (KO1 & KO2) using antibodies to APMAP (labeled in red) and actin (green) demonstrates the loss of APMAP expression in the null clones. (B) SVG-A (WT) cells and APMAP null clones KO1 and KO2 were challenged with JCPyV and infection scored by indirect immunofluorescence for the viral protein VP1. (C) Western blot demonstrating APMAP expression in KO1 cells is restored by transient transfection with a plasmid expressing human APMAP with a mutated guide sequence region (gRNA APMAP). APMAP is labeled in red, actin in green as in (A). The vector-derived APMAP is slightly larger than wildtype APMAP due to a 3X flag-tag sequence from the vector that adds an additional 2.8 KDa to the C-terminal end of endogenous APMAP. (D) Susceptibility to JCPyV infection of APMAP KO1 cells was rescued by transfecting the cells with the APMAP expression plasmid expressing APMAP compared to empty control Flag expression vector without the APMAP insert. The results represent the average of three independent experiments performed in triplicate. Error bars represent SD. *p<0.05

Article Snippet: Cells at 80% confluence were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) with 2 μg of DNA per well of human APMAP in pEZ-M14 (Genecopeia, #EX-V0537-M14).

Techniques: Western Blot, Clone Assay, Labeling, Expressing, Infection, Immunofluorescence, Transfection, Plasmid Preparation, Sequencing, Derivative Assay, FLAG-tag, Control

Journal: Frontiers in Immunology

Article Title: Endoplasmic reticulum stress-induced CRELD2 promotes APMAP-mediated activation of TGF-β/SMAD and NF-κB pathways in esophageal squamous cell carcinoma

doi: 10.3389/fimmu.2025.1616201

Figure Lengend Snippet: CRELD2 increases the membrane localization of APMAP. (A) The interaction between CRELD2 and APMAP was detected in the indicated cells by co-immunoprecipitation assay using anti-CRELD2 followed by immunoblot with anti-APMAP or anti-CRELD2. (B) The expression profile of APMAP was systematically analyzed in tumor tissues and paired normal counterparts using the UALCAN database. (C, D) qRT-PCR (C) and Western blot (D) analysis of APMAP expression in HEEC and ESCC cell lines (TE1, KYSE150, and KYSE170). (E) qRT-PCR and Western blot analysis of CRELD2 and APMAP expression in TE1 and KYSE150 cells with CRELD2 overexpression or knockdown. (F) qRT-PCR assay of KYSE150 and TE1 cells treated with Tg (+) or DMSO (–) for 12 h. (G) The subcellular localization of APMAP in KYSE150 cells treated as indicated was measured by immunofluorescence staining. Nuclei are stained with DAPI. Arrows indicate plasma membrane localization of APMAP. Scale bar, 25 μm. (H) Western blot showing APMAP expression in the membrane fraction from each treatment condition. The protein levels were quantified by band densitometry. Data represent the mean ± SD of three independent experiments. *P < 0.05, **P < 0.01, n.s., not significant.

Article Snippet: Antibodies against APMAP (25953-1-AP, Proteintech, Wuhan, China), ZEB2 (67514-1-Ig, Proteintech, Wuhan, China), XBP1s (647501, Biolegend, San Diego, CA, USA), TGFBR1 (ab235578, Abcam, Cambridge, UK), CRELD2 (sc-365168, Santa Cruz Biotechnology, Dallas, Texas, USA), TAB2 (A9867, ABclonal Technology, Wuhan, China), TAB1 (RT1603, HuaBio, Hangzhou, China) were also respectively used.

Techniques: Membrane, Co-Immunoprecipitation Assay, Western Blot, Expressing, Quantitative RT-PCR, Over Expression, Knockdown, Immunofluorescence, Staining, Clinical Proteomics

Journal: Frontiers in Immunology

Article Title: Endoplasmic reticulum stress-induced CRELD2 promotes APMAP-mediated activation of TGF-β/SMAD and NF-κB pathways in esophageal squamous cell carcinoma

doi: 10.3389/fimmu.2025.1616201

Figure Lengend Snippet: APMAP activates TGF-β/SMAD and NF-κB signaling during ER stress-induced EMT and proliferation. (A) qRT-PCR analysis of EMT and proliferation marker expression in KYSE150 and TE1 cells transfected with control siRNA (si-NC) or si-APMAP. (B) Western blot analysis of the indicated proteins expression in KYSE150 and TE1 cells transfected with si-NC or si-APMAP. (C) The protein expression of key genes of the TGF-β/SMAD, NF-κB, IL6/STAT3, Wnt/β-catenin, and PI3K/AKT signaling pathways in APMAP-knockdown KYSE150 and TE1 cells was examined by Western blot assay. (D) The effect of APMAP knockdown on the protein expression of SMAD2/3 and p-SMAD2/3 in Tg (100 nM, 12 h) treated KYSE150 and TE1 cells. (E, F) Co-immunoprecipitation assay was conducted with anti-TGFBR1 or anti-APMAP antibodies followed by immunoblot with anti-TAK1, anti-TGFBR1 or anti-APMAP in the indicated cells. (G) Western blot analysis of p-TAK1 and TAK1 expression in APMAP-manipulated KYSE150 cells and TE1 cells (overexpression or knockdown). (H) Co-immunoprecipitation assay was conducted with anti-APMAP antibody followed by immunoblot with anti-TAB1, anti-TAB2, or anti-APMAP in the indicated cells. (I) The proposed model for ER stress-induced CRELD2 promotes membrane the localization of APMAP, which increases its interaction with TAK1, TAB1, and TAB2, thereby promoting the activation of the TGF-β/SMAD and NF-κB pathways and inducing the EMT and proliferation of ESCC cells, is shown. The protein levels were quantified by band densitometry. Data represent the mean ± SD of three independent experiments. *P < 0.05, **P < 0.01.

Article Snippet: Antibodies against APMAP (25953-1-AP, Proteintech, Wuhan, China), ZEB2 (67514-1-Ig, Proteintech, Wuhan, China), XBP1s (647501, Biolegend, San Diego, CA, USA), TGFBR1 (ab235578, Abcam, Cambridge, UK), CRELD2 (sc-365168, Santa Cruz Biotechnology, Dallas, Texas, USA), TAB2 (A9867, ABclonal Technology, Wuhan, China), TAB1 (RT1603, HuaBio, Hangzhou, China) were also respectively used.

Techniques: Quantitative RT-PCR, Marker, Expressing, Transfection, Control, Western Blot, Protein-Protein interactions, Knockdown, Co-Immunoprecipitation Assay, Over Expression, Membrane, Activation Assay

Journal: PLoS Pathogens

Article Title: Identification of adipocyte plasma membrane-associated protein as a novel modulator of human cytomegalovirus infection

doi: 10.1371/journal.ppat.1007914

Figure Lengend Snippet: ( A ) APMAP mRNA level in wildtype ARPE-19, vector control and APMAP K/O cells were quantified by RT-qPCR. GAPDH mRNA served as internal control. The data were shown as relative APMAP mRNA level to that of wildtype ARPE-19 cells. The bars represent means ± SD of replicate wells. ( B ) APMAP knockout in ARPE-19 cells were confirmed by western blot analysis using 4F6 mAb which recognizes APMAP. GAPDH served as loading control. ( C ) Sequencing of APMAP gene of wildtype ARPE-19 and the APMAP K/O cells revealed two amino acids deletion in APMAP genes near the transmembrane domain in the K/O cells. ( D ) Wildtype ARPE-19 and APMAP K/O cells grown in 96-well plate were infected with AD169rev-GFP at MOI = 1.0, and the images were taken at 48 h after infection to detect GFP expression. Bar = 100 μm. ( E ) Quantitation of GFP positive cells in (D). Total number of GFP positive cells per well were shown. The bars represent means ± SD of GFP positive cells in four replicate wells. ( F ) Detection of HCMV protein expression in (D) by western blot analysis using anti-gH, anti-pp65, and anti-gO antibodies, respectively. β-actin served as loading control. The APMAP mRNA level (%) or number of GFP+ cells in vector control and APMAP K/O cells were compared individually to that of wildtype ARPE-19 cells using unpaired two-tailed student t-test for significance analysis.

Article Snippet: A mouse mAb 4F6 that recognizes APMAP was obtained from OriGene (Cat#: TA504220).

Techniques: Plasmid Preparation, Quantitative RT-PCR, Knock-Out, Western Blot, Sequencing, Infection, Expressing, Quantitation Assay, Two Tailed Test

Journal: PLoS Pathogens

Article Title: Identification of adipocyte plasma membrane-associated protein as a novel modulator of human cytomegalovirus infection

doi: 10.1371/journal.ppat.1007914

Figure Lengend Snippet: ( A ) APMAP knockdown MRC-5 stable cells were generated by infection with lentivirus expressing APMAP specific shRNA under puromycin selection. APMAP mRNA level in the knockdown cells were detected by RT-qPCR. GAPDH mRNA served as internal control. The data are shown as percentages of APMAP mRNA levels in knockdown cells relative to that of MRC-5 cells. ( B ) Wildtype and APMAP K/D MRC-5 cells were infected with AD169rev-GFP and AD169-GFP at MOI = 1.0 in 96-well plate, respectively. 6 h after infection, the cells were collected for RNA extraction and RT-qPCR to detect viral IE mRNA level. The data were shown as percentages of IE mRNA level in infected knockdown cells relative to that of MRC-5 cells. GAPDH mRNA served as internal control. ( C-G ) In another HCMV infection experiment as in , ( C ) 48 h after infection, the plate was read by C.T.L. Immunospot machine to capture images under fluorescence cell mode for GFP. GFP positive cells in each well were counted automatically using the software. The data are shown as means ± SD of total number of GFP positive cells per well for four replicate wells. ( D-G ) 72 h after infection, ( F-G ) representative images (Bar = 100 μm) showing overall GFP positive cells were captured by Olympus fluorescence microscopy; and then ( D-E ) the cells were collected for western blot assay to detect HCMV protein expression using anti-pp65, anti-gH and anti-APMAP (4F6) antibodies, respectively. β-actin served as loading control. The APMAP mRNA level (%), IE mRNA level (%), or number of GFP+ cells in sc-shRNA or shAPMAP expressing cells were compared individually to that of wildtype MRC-5 cells using unpaired two-tailed student t-test for significance analysis. The data shown are representative results of two independent experiments.

Article Snippet: A mouse mAb 4F6 that recognizes APMAP was obtained from OriGene (Cat#: TA504220).

Techniques: Generated, Infection, Expressing, shRNA, Selection, Quantitative RT-PCR, RNA Extraction, Fluorescence, Software, Microscopy, Western Blot, Two Tailed Test

Journal: PLoS Pathogens

Article Title: Identification of adipocyte plasma membrane-associated protein as a novel modulator of human cytomegalovirus infection

doi: 10.1371/journal.ppat.1007914

Figure Lengend Snippet: ( A-B ) APMAP O/E stable cells were established by infecting ARPE-19 cells with lentivirus particles capable of expressing full length APMAP coding sequence with a Myc/Flag tag at C-terminus under puromycin selection. APMAP over expression in ARPE-19 cells were confirmed by ( A ) western blot using mouse mAb anti-Flag tag and ( B ) RT-qPCR, respectively. GAPDH served as internal control. ( C-E ) ARPE-19 APMAP K/O, APMAP O/E, and control cells were infected with AD169rev-GFP at MOI = 1.0 in 96-well plate. At 8 h after infection, the cells were collected for RNA extraction and RT-PCR to detect ( C ) HCMV IE mRNA level and ( D ) pp65 mRNA level, respectively, and shown as percentages to that infected ARPE-19 cells, with GAPDH mRNA served as internal control. No significant signal for IE and pp65 mRNA in mock-infected cells could be detected by the primers and thus was not shown. Data analysis was performed using the 2 -ΔΔCT method. The data are shown as relative IE or pp65 mRNA level to that of infected wildtype cells. The black bars represent means ± SD of replicate wells. ( E ) In another infection experiment, the plate was read by C.T.L. Immunospot machine at 48 h post infection. Number of GFP positive cells were counted automatically using the software. The data are shown as means ± SD of total number of GFP positive cells per well for triplicate wells. The APMAP mRNA level (%), IE mRNA level (%), or number of GFP+ cells in vector contol, APMAP K/O and APMAP O/E cells were compared individually to that of wildtype MRC-5 cells using unpaired two-tailed student t-test for significance analysis. ( F ) At 72 h after infection, the cells were collected to detect HCMV protein expression by western blot, using anti-pp65, anti-gH and anti-gO antibodies, respectively. β-actin served as loading control.

Article Snippet: A mouse mAb 4F6 that recognizes APMAP was obtained from OriGene (Cat#: TA504220).

Techniques: Expressing, Sequencing, FLAG-tag, Selection, Over Expression, Western Blot, Quantitative RT-PCR, Infection, RNA Extraction, Reverse Transcription Polymerase Chain Reaction, Software, Plasmid Preparation, Two Tailed Test

Journal: PLoS Pathogens

Article Title: Identification of adipocyte plasma membrane-associated protein as a novel modulator of human cytomegalovirus infection

doi: 10.1371/journal.ppat.1007914

Figure Lengend Snippet: ( A ) APMAP O/E stable cells were established by infecting MDCK cells with lentivirus particles capable of expressing human full length APMAP coding sequence with a myc/flag tag at C-terminal under puromycin selection. APMAP over expression in MDCK cells were confirmed by western blot analysis using mouse anti-Flag tag or anti-APMAP (4F6) antibodies. β-actin served as loading control. ( B-G ) Wildtype MDCK and APMAP O/E stable cells were infected with AD169rev-GFP and AD169-GFP at MOI = 1.0 in 96-well plate, respectively. ( B-C ) At 2 days post infection, the plate was read by C.T.L. Immunospot machine to capture images under fluorescence cell mode for GFP. GFP positive cells in each well were counted automatically using the software. The data are shown as means ± SD of total number of GFP positive cells per well for four replicate wells. ( D-E ) Representative images (Bar = 100 μm) showing overall GFP positive cells at day 2 post infection by ( D ) AD169rev-GFP or ( E ) AD169-GFP were captured using an Olympus fluorescence microscope. ( F-G ) The cells were collected at 2 days after infection for qRT-PCR detection of viral IE and pp65 mRNA. GAPDH mRNA served as internal control. Data analysis was performed using the 2 -ΔΔCT method. The data are shown as relative percentages of IE or pp65 mRNA level to that of infected wildtype cells. The number of GFP+ cells, relative IE mRNA level or pp65 mRNA level in vector contol and APMAP O/E cells were compared individually to that of wildtype MDCK cells using unpaired two-tailed student t-test for significance analysis. The black bars represent means ± SD for triplicate wells.

Article Snippet: A mouse mAb 4F6 that recognizes APMAP was obtained from OriGene (Cat#: TA504220).

Techniques: Expressing, Sequencing, FLAG-tag, Selection, Over Expression, Western Blot, Infection, Fluorescence, Software, Microscopy, Quantitative RT-PCR, Plasmid Preparation, Two Tailed Test

Journal: PLoS Pathogens

Article Title: Identification of adipocyte plasma membrane-associated protein as a novel modulator of human cytomegalovirus infection

doi: 10.1371/journal.ppat.1007914

Figure Lengend Snippet: ( A-B ) The interaction of ( A ) Pentamer or ( B ) gH/gL dimer to APMAP at indicated concentrations in neutral pH 7.0 or acid pH 5.5 buffer was evaluated by ELISA assay. APMAP-Fc served as coating antigen. Pentamer was detected with HRP conjugated anti-His-tag antibodies which recognizes gH subunit of the pentamer. Samples with OD450nm readings that are 1.5 times higher than that of BSA control were considered positive. The data shown are representative results of two independent experiments. The bars represent means ± SD of replicate wells. ( C-D ) 1 μg APMAP-Fc or control CD47-Fc protein was incubated with 2.58×10 6 PFU of AD169rev ( C ) in 500 μl PBS or ( D ) 500 μl RIPA buffer for 2 h at 4°C. The protein complex was pulled down by Protein G beads and analyzed by western blot assay using anti-gH mAb, anti-pp65 mAb and HRP conjugated anti-mouse IgG antibodies. ( E ) 2 μg APMAP-Fc or control CD47-Fc protein was loaded onto Protein G beads and then incubated with different amounts of His-tagged pp65 protein at room temperature for 1 h. After washing away of unbound protein, the beads were suspended into SDS containing loading buffer for western blot assay using mouse anti-His-tag mAb and HRP conjugated goat anti-mouse IgG secondary antibodies. ( F ) The binding of His-tagged pp65 to APMAP-Fc was detected by BLI assay using protein A sensors. The binding of kinetic buffer to APMAP-Fc loaded sensor were used as reference and subtracted before data analysis.

Article Snippet: A mouse mAb 4F6 that recognizes APMAP was obtained from OriGene (Cat#: TA504220).

Techniques: Enzyme-linked Immunosorbent Assay, Incubation, Western Blot, Binding Assay

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) SVG-A cells preincubated with anti-APMAP antisera and then infected with JCPyV exhibit reduced infection compared to cells preincubated with isotype control antibody. Post infection, cells were fixed and stained with anti-VP1 antibody (green) and nuclei were counterstained with DAPI (blue). (B) Quantification of VP1(+) nuclei. Experiments were performed three times in triplicate. Error bars represent SD. *p<0.05

Article Snippet: Transient knock-down of APMAP using small interfering RNAs APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Infection, Control, Staining

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) SVG-A cells were untreated or treated with control nontargeting siRNA (NegC) or one of four different APMAP-specific siRNAs for 72 hours and then infected with JCPyV. Post-infection, cells were fixed and stained for VP1 and counterstained with DAPI, and VP1(+) nuclei quantified. (B) siRNA knockdown of APMAP decreases APMAP protein in SVG-A cells. (C) Quantification of western blot band intensity using Odyssey software. The results represent the average of two independent experiments performed in triplicate. Error bars represent SD. *p<0.05

Article Snippet: Transient knock-down of APMAP using small interfering RNAs APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Control, Infection, Staining, Knockdown, Western Blot, Software

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) SVG-A cells were treated with either methanol control or an inhibitor of N-glycosylation, tunicamycin. Cells were assayed by western blot for deglycosylation after 24, 48 and 72 hours. (B) Immunoprecipitated APMAP treated with either PNGaseF or neuraminidase from C. perfringens also demonstrated deglycosylation. * = deglycosylated APMAP. (C) APMAP is found primarily on the cell surface of SVG-A cells. Cells were labeled with APMAP antisera, washed and incubated with fluorescently labeled secondary antibody, then analyzed by flow cytometry. (D) Cellular fractionation further supports APMAP is localized to the plasma membrane.

Article Snippet: Transient knock-down of APMAP using small interfering RNAs APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Control, Glycoproteomics, Western Blot, Immunoprecipitation, Labeling, Incubation, Flow Cytometry, Cell Fractionation, Clinical Proteomics, Membrane

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) Western blot analysis of wild type SVG-A (WT) cells or two APMAP null clones (KO1 & KO2) using antibodies to APMAP (labeled in red) and actin (green) demonstrates the loss of APMAP expression in the null clones. (B) SVG-A (WT) cells and APMAP null clones KO1 and KO2 were challenged with JCPyV and infection scored by indirect immunofluorescence for the viral protein VP1. (C) Western blot demonstrating APMAP expression in KO1 cells is restored by transient transfection with a plasmid expressing human APMAP with a mutated guide sequence region (gRNA APMAP). APMAP is labeled in red, actin in green as in (A). The vector-derived APMAP is slightly larger than wildtype APMAP due to a 3X flag-tag sequence from the vector that adds an additional 2.8 KDa to the C-terminal end of endogenous APMAP. (D) Susceptibility to JCPyV infection of APMAP KO1 cells was rescued by transfecting the cells with the APMAP expression plasmid expressing APMAP compared to empty control Flag expression vector without the APMAP insert. The results represent the average of three independent experiments performed in triplicate. Error bars represent SD. *p<0.05

Article Snippet: Transient knock-down of APMAP using small interfering RNAs APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Western Blot, Clone Assay, Labeling, Expressing, Infection, Immunofluorescence, Transfection, Plasmid Preparation, Sequencing, Derivative Assay, FLAG-tag, Control

Journal: Human Molecular Genetics

Article Title: The adipocyte differentiation protein APMAP is an endogenous suppressor of Aβ production in the brain

doi: 10.1093/hmg/ddu449

Figure Lengend Snippet: Identification of endogenous modulators of γ-secretase and Aβ production. ( A ) Analysis by LC-MS/MS of the protein components of the highly purified γ-secretase complex. ( B and C ) siRNA knockdown of TSPAN6, RTN4 and APMAP affects APP-CTFs in HeLa cells (B) and HEK cells overexpressing APP bearing the Swedish mutation that causes early-onset familial Alzheimer's disease (HEK-APPSwe; C). Biological duplicates are shown for each siRNA condition. ( D ) Correlation between APP-CTFs levels and Aβ40 production in HEK-APPSwe cells with reduced TSPAN6, RTN4 and APMAP expression. APP-CTFs levels were estimated by densitometric analysis, while Aβ40 levels were quantified by ELISA. Student's t -test was applied for statistical analysis; significance is shown as mean ± SD, * P < 0.05; ** P < 0.01; Aβ40: n = 6/group; APP-CTFs: n = 4/Scramble, TSPAN6and APMAP groups; n = 3/RTN4 group. β-Actin served as a protein loading control. mAPP-FL and iAPP-FL: mature and immature APP full-length.

Article Snippet: Following the blocking step, the cells were incubated with antibodies against APMAP (GTX46051, Gentex, Irvine, CA, USA), APP-CTFs (4G8, AbCam Cambridge, UK) or Nicastrin (NCT164, BD Bio-Sciences, Franklin Lakes, NJ, USA).

Techniques: Liquid Chromatography with Mass Spectroscopy, Purification, Knockdown, Mutagenesis, Expressing, Enzyme-linked Immunosorbent Assay, Control

Journal: Human Molecular Genetics

Article Title: The adipocyte differentiation protein APMAP is an endogenous suppressor of Aβ production in the brain

doi: 10.1093/hmg/ddu449

Figure Lengend Snippet: APMAP controls the levels and the stability of APP-CTFs. ( A ) siRNA knockdown of APMAP in HeLa cells quantitatively and qualitatively impacts APP-CTFs. Reduced APMAP expression correlates with increased APP-CTFs and the formation of three forms of APP-CTFα (CTFα1, α2 and α3), as revealed on a Tris-Tricine urea gel (left panel). This phenotype is further amplified in the presence of 1 µ m GSI DAPT (right panel). Biological triplicates are shown. ( B ) MALDI-TOF mass spectrometric analysis of APP-CTFα1, α2 and α3 immunoprecipitated from DAPT-treated cells with siRNA-reduced APMAP expression. ( C ) Peptide sequences of N-terminal truncated APP-CTFα1 (C80), -CTFα2 (C74) and -CTFα3 (C71).

Article Snippet: Following the blocking step, the cells were incubated with antibodies against APMAP (GTX46051, Gentex, Irvine, CA, USA), APP-CTFs (4G8, AbCam Cambridge, UK) or Nicastrin (NCT164, BD Bio-Sciences, Franklin Lakes, NJ, USA).

Techniques: Knockdown, Expressing, Amplification, Immunoprecipitation

Journal: Human Molecular Genetics

Article Title: The adipocyte differentiation protein APMAP is an endogenous suppressor of Aβ production in the brain

doi: 10.1093/hmg/ddu449

Figure Lengend Snippet: APMAP interacts physically and co-localizes with γ-secretase, APP-FL and APP-CTFs. ( A ) Velocity co-sedimentation and co-immunoprecipitation of APMAP with the γ-secretase complex, APP-FL and APP-CTFs. Total membrane protein extracts from HEK-APPSwe cells transiently overexpressing hAPMAP1 or hAPMAP1-Flag were sedimented on an 18–28% glycerol gradient containing 0.1% CHAPSO. Each fraction was collected and analyzed by western blot for APMAP1, APP-FL, APP-CTFs and mature and immature γ-secretase (top panels). Next, proteins interacting with hAPMAP1-Flag (Flag) were affinity-precipitated in the fractions labeled in red with M2 anti-Flag affinity resin (lower panel). Untagged APMAP (hAPMAP1, also labeled ‘-’ in the figure) served as a control for the specific co-precipitation. ( B ) Immunohistochemical co-localization of APMAP (green) with the γ-secretase subunit Nicastrin (red, upper panel) or APP (red, lower panel) in 14 days in vitro mouse primary cortical neurons. Scale bar: 10 µm. Both confocal images (left panels) and Z-stack projections (right panels) are shown with a microscope objective magnification of 40×. For comparison, un-merged images for APMAP, NCT, APP-CTFs and DAPI are shown in Supplementary Material, Fig. S10 . mNCT and iNCT, mature and immature Nicastrin.

Article Snippet: Following the blocking step, the cells were incubated with antibodies against APMAP (GTX46051, Gentex, Irvine, CA, USA), APP-CTFs (4G8, AbCam Cambridge, UK) or Nicastrin (NCT164, BD Bio-Sciences, Franklin Lakes, NJ, USA).

Techniques: Sedimentation, Immunoprecipitation, Membrane, Western Blot, Labeling, Control, Immunohistochemical staining, In Vitro, Microscopy, Comparison

Journal: Human Molecular Genetics

Article Title: The adipocyte differentiation protein APMAP is an endogenous suppressor of Aβ production in the brain

doi: 10.1093/hmg/ddu449

Figure Lengend Snippet: APMAP modulates Aβ production in vivo. Five-week-old wild-type ( A and B ) or APP/PS1 transgenic ( C and D ) male mice were injected in the dorsal hippocampus with AAV9 expressing APMAP shRNA or a scrambled control shRNA, together with a GFP reporter. Four weeks post-injection, AAV9 transduction is highly efficient and is mainly restricted to the hippocampus (A and C). Wild-type (B) or APP/PS1 (D) males displayed significant ∼50% and ∼35% decreases of APMAP expression (mean ± SD; *** P < 0.001; n = 6/group), associated with significant ∼20 and ∼55% increases in total Aβ levels in the hippocampus (* P < 0.05; ** P < 0.01; n = 6/group). Student's t -test was applied for the statistical analysis. β-Actin served as a protein loading control. (A and C) Scale bar: 500 µm.

Article Snippet: Following the blocking step, the cells were incubated with antibodies against APMAP (GTX46051, Gentex, Irvine, CA, USA), APP-CTFs (4G8, AbCam Cambridge, UK) or Nicastrin (NCT164, BD Bio-Sciences, Franklin Lakes, NJ, USA).

Techniques: In Vivo, Transgenic Assay, Injection, Expressing, shRNA, Control, Transduction

Journal: Human Molecular Genetics

Article Title: The adipocyte differentiation protein APMAP is an endogenous suppressor of Aβ production in the brain

doi: 10.1093/hmg/ddu449

Figure Lengend Snippet: APMAP regulates cellular APP-CTFs levels through the lysosomal–autophagic pathway. HEK-APPSwe ( A ) and HeLa ( B ) cells treated either with a scrambled control siRNA or with APMAP siRNA were incubated for 12 h with the lysosomal inhibitor Chloroquine (25 and 50 µM, respectively). Total membrane protein extracts were prepared and analyzed by western blot for APMAP1, APP-FL and APP-CTFs (left panels). Biological duplicates are shown and β-actin served as a protein loading control. Next, APP-CTFs bands were quantified by densitometry (right panels) and Student's t -test was applied for statistical analysis with n = 4/group. ** P < 0.01; *** P < 0.001.

Article Snippet: Following the blocking step, the cells were incubated with antibodies against APMAP (GTX46051, Gentex, Irvine, CA, USA), APP-CTFs (4G8, AbCam Cambridge, UK) or Nicastrin (NCT164, BD Bio-Sciences, Franklin Lakes, NJ, USA).

Techniques: Control, Incubation, Membrane, Western Blot

Journal: Human Molecular Genetics

Article Title: The adipocyte differentiation protein APMAP is an endogenous suppressor of Aβ production in the brain

doi: 10.1093/hmg/ddu449

Figure Lengend Snippet: Molecular hypothesis for the regulation of APP-CTFs/Aβ levels by APMAP. In this hypothesis, APMAP is implicated in the transport of APP-CTFs to the lysosomal–autophagic system, where it undergoes substrate degradation. Consistent with the observed cellular phenotypes (Figs and ), depletion of APMAP would impair this transport capacity and consequently trigger increased APP-CTFs levels, which in turn cause increased Aβ production. Impaired degradation would further make APP-CTFs substrates accessible to yet unidentified proteases, explaining the N-terminal truncated species observed in cells with depleted APMAP (Fig. ).

Article Snippet: Following the blocking step, the cells were incubated with antibodies against APMAP (GTX46051, Gentex, Irvine, CA, USA), APP-CTFs (4G8, AbCam Cambridge, UK) or Nicastrin (NCT164, BD Bio-Sciences, Franklin Lakes, NJ, USA).

Techniques:

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) SVG-A cells preincubated with anti-APMAP antisera and then infected with JCPyV exhibit reduced infection compared to cells preincubated with isotype control antibody. Post infection, cells were fixed and stained with anti-VP1 antibody (green) and nuclei were counterstained with DAPI (blue). (B) Quantification of VP1(+) nuclei. Experiments were performed three times in triplicate. Error bars represent SD. *p<0.05

Article Snippet: APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Infection, Control, Staining

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) SVG-A cells were untreated or treated with control nontargeting siRNA (NegC) or one of four different APMAP-specific siRNAs for 72 hours and then infected with JCPyV. Post-infection, cells were fixed and stained for VP1 and counterstained with DAPI, and VP1(+) nuclei quantified. (B) siRNA knockdown of APMAP decreases APMAP protein in SVG-A cells. (C) Quantification of western blot band intensity using Odyssey software. The results represent the average of two independent experiments performed in triplicate. Error bars represent SD. *p<0.05

Article Snippet: APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Control, Infection, Staining, Knockdown, Western Blot, Software

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) SVG-A cells were treated with either methanol control or an inhibitor of N-glycosylation, tunicamycin. Cells were assayed by western blot for deglycosylation after 24, 48 and 72 hours. (B) Immunoprecipitated APMAP treated with either PNGaseF or neuraminidase from C. perfringens also demonstrated deglycosylation. * = deglycosylated APMAP. (C) APMAP is found primarily on the cell surface of SVG-A cells. Cells were labeled with APMAP antisera, washed and incubated with fluorescently labeled secondary antibody, then analyzed by flow cytometry. (D) Cellular fractionation further supports APMAP is localized to the plasma membrane.

Article Snippet: APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Control, Glycoproteomics, Western Blot, Immunoprecipitation, Labeling, Incubation, Flow Cytometry, Cell Fractionation, Clinical Proteomics, Membrane

Journal: Virology

Article Title: Adipocyte Plasma Membrane Protein (APMAP) promotes JC Virus (JCPyV) Infection in Human Glial Cells

doi: 10.1016/j.virol.2020.06.002

Figure Lengend Snippet: (A) Western blot analysis of wild type SVG-A (WT) cells or two APMAP null clones (KO1 & KO2) using antibodies to APMAP (labeled in red) and actin (green) demonstrates the loss of APMAP expression in the null clones. (B) SVG-A (WT) cells and APMAP null clones KO1 and KO2 were challenged with JCPyV and infection scored by indirect immunofluorescence for the viral protein VP1. (C) Western blot demonstrating APMAP expression in KO1 cells is restored by transient transfection with a plasmid expressing human APMAP with a mutated guide sequence region (gRNA APMAP). APMAP is labeled in red, actin in green as in (A). The vector-derived APMAP is slightly larger than wildtype APMAP due to a 3X flag-tag sequence from the vector that adds an additional 2.8 KDa to the C-terminal end of endogenous APMAP. (D) Susceptibility to JCPyV infection of APMAP KO1 cells was rescued by transfecting the cells with the APMAP expression plasmid expressing APMAP compared to empty control Flag expression vector without the APMAP insert. The results represent the average of three independent experiments performed in triplicate. Error bars represent SD. *p<0.05

Article Snippet: APMAP specific siRNA and control siRNA were obtained from Qiagen (APMAP siRNA Flexitube Gene Solution #GS57136; APMAP 1: CAAGGGACTATTTGAAGTAAA; APMAP 2: CTGGGTGGGCATGTCGACCAT; APMAP 3: CATGCTGGATTTCTTATCTGA; APMAP 4: TTCACCGATTCTAGCAGCAAA) and Flexitube All Stars Negative Control siRNA # SI03650318.

Techniques: Western Blot, Clone Assay, Labeling, Expressing, Infection, Immunofluorescence, Transfection, Plasmid Preparation, Sequencing, Derivative Assay, FLAG-tag, Control