Journal: British Journal of Pharmacology

Article Title: High glucose‐mediated PICALM and mTORC1 modulate processing of amyloid precursor protein via endosomal abnormalities

doi: 10.1111/bph.15131

Figure Lengend Snippet: High glucose increased PICALM, AP2A1, and CHC expression through ROS‐stimulated Sp1 nuclear translocation. (a) The SK‐N‐MC cells were treated with distilled water (DW) or 25 mM high glucose in a time response. Intracellular ROS was measured by DCF‐DA staining and analysed by flow cytometry. n = 5 from independent experiments. (b,c) The cells were incubated with NAC (4 mM) for 30 min prior to high glucose treatment (25 mM) for 6 h. (b) Sp1, β‐tubulin, and Lamin A/C in cytosolic and nuclear fraction samples were detected by western blot. n = 5 from independent experiments. (c) The cells were immunostained with Sp1‐specific antibody and counterstained with DAPI. Scale bars, 8 μm (magnification, ×1,000). n = 5 from independent experiments. (d) The cells were pretreated with Mithramycin A (25 nM) for 30 min before high glucose treatment (25 mM) for 12 h. mRNA expression levels of PICALM, AP2A1, and CHC were analysed by quantitative real‐time PCR. n = 5 from independent experiments with two technical replicates each. Logarithmic transformations were performed for homogeneity of the sample variance. (e) The cells were incubated with Mithramycin A (25 nM) for 30 min prior to high glucose treatment (25 mM) for 24 h. PICALM, AP2A1, CHC, and β‐actin were subjected to western blot. n = 5 from independent experiments. *P < .05, significantly different from control, # P < .05, significantly different from high glucose. (f) The hippocampal samples were obtained from ZLC and ZDF rats. PICALM, AP2A1, CHC, and β‐actin were detected by western blot. n = 5 in each group. *P < .05, significantly different from ZLC rats. (g) The hippocampal samples were obtained from vehicle‐ and STZ‐treated mice. PICALM, AP2A1, CHC, and β‐actin were detected by western blot. n = 5 in each group. *P < .05, significantly different from vehicle‐treated mice. Quantitative data are presented as a mean ± SEM. All blots and immunofluorescence images are representative

Article Snippet: The antibodies to β‐tubulin (CSB‐PA03874A0Rb) and AP2A1 (610502) were purchased from Cusabio (Wuhan, Hubei, China) and BD Biosciences (San Jose, CA, USA), respectively.

Techniques: Expressing, Translocation Assay, Staining, Flow Cytometry, Incubation, Western Blot, Real-time Polymerase Chain Reaction, Control, Immunofluorescence

Journal: British Journal of Pharmacology

Article Title: High glucose‐mediated PICALM and mTORC1 modulate processing of amyloid precursor protein via endosomal abnormalities

doi: 10.1111/bph.15131

Figure Lengend Snippet: PICALM facilitates clathrin‐dependent APP endocytosis under high glucose conditions. (a,b) The SK‐N‐MC cells were transfected with NT siRNA or PICALM siRNA for 12 h and then treated with Pitstop 2 (30 μM) for 30 min prior to high glucose treatment (25 mM) for 24 h. (a) The cells were immunostained with APP‐ and AP2A1‐specific antibodies and counterstained with DAPI. Scale bars, 8 μm (magnification, ×1,000). n = 5 from independent experiments. (b) The cells were immunostained with APP‐ and CHC‐specific antibodies and counterstained with DAPI. Scale bars, 8 μm (magnification, ×1,000). n = 5 from independent experiments. *P < .05, significantly different from NT siRNA transfection, # P < .05, significantly different from high glucose with NT siRNA transfection. (c) Internalization assay from the cells treated with high glucose (25 mM) for 24 h was done by immunostaining with Aβ for surface‐labelled APP and PICALM specific antibodies. 0 and 15 min indicate time points of internalization. Scale bars, 8 μm (magnification, ×1,000). n = 5 from independent experiments. (d,e) The SK‐N‐MC cells were transfected with NT siRNA or PICALM siRNA for 12 h and then treated with GM6001 (20 μM) for 30 min prior to high glucose treatment (25 mM) for 24 h. (d) Cell surface was biotinylated, and labelled proteins were pulled down by streptavidin beads. Surface APP, total APP, and β‐actin were detected by western blot. n = 5 from independent experiments. (e) Biotin surface labelling and internalization assay including 15 min for internalization were done. Internalized APP, total APP, and β‐actin were detected by western blot. n = 5 from independent experiments. (f) The cells were transfected with NT siRNA or PICALM siRNA for 12 h prior to high glucose treatment (25 mM) for 48 h. Aβ 1–42 from cell culture medium were measured by human Aβ 1–42 specific ELISA assay. n = 5 from independent experiments with two technical replicates each. *P < .05, significantly different from NT siRNA transfection, # P < .05, significantly different from high glucose with NT siRNA transfection. (g) The cells were pretreated with GM6001 (20 μM) for 30 min and then treated with Dynasore (25 μM) for 30 min before high glucose treatment (25 mM) for 24 h. Cell surface was biotinylated, and labelled proteins were pulled down by streptavidin beads. Surface APP, total APP, and β‐actin were detected by western blot. n = 5 from independent experiments. (h) The cells were pretreated with Dynasore (25 μM) for 30 min immunostained with Rab5‐specific antibody and counterstained with DAPI. Scale bars, 8 μm (magnification, ×1,000). n = 5 from independent experiments. (i) The cells were incubated with Dynasore (25 μM) for 30 min prior to high glucose treatment (25 mM) for 48 h. Aβ 1–42 from cell culture medium were measured by human Aβ 1–42 specific ELISA assay. n = 5 from independent experiments with two technical replicates each. Logarithmic transformations were performed for homogeneity of the sample variance. *P < .05, significantly different from control, # P < .05, significantly different from high glucose . Quantitative data are presented as a mean ± SEM. All blots and immunofluorescence images are representative

Article Snippet: The antibodies to β‐tubulin (CSB‐PA03874A0Rb) and AP2A1 (610502) were purchased from Cusabio (Wuhan, Hubei, China) and BD Biosciences (San Jose, CA, USA), respectively.

Techniques: Transfection, Immunostaining, Western Blot, Cell Culture, Enzyme-linked Immunosorbent Assay, Incubation, Control, Immunofluorescence

Journal: British Journal of Pharmacology

Article Title: High glucose‐mediated PICALM and mTORC1 modulate processing of amyloid precursor protein via endosomal abnormalities

doi: 10.1111/bph.15131

Figure Lengend Snippet: Diagram of the pathways underlying the up‐regulation of Aβ production by abnormalities in early endosomes, under high glucose conditions. High glucose increased PICALM, AP2A1, and CHC expression through ROS‐stimulated Sp1 nuclear translocation. PICALM facilitates clathrin‐mediated APP endocytosis at lipid rafts, which induces early endosomal enlargement. On the one hand, high glucose impairs endosomal clearance via AMPK/mTORC1‐ and ROS‐mediated auto‐lysosomal dysregulation. The consequences of abnormalities in early endosomes are overproduction of Aβ and cognitive impairment

Article Snippet: The antibodies to β‐tubulin (CSB‐PA03874A0Rb) and AP2A1 (610502) were purchased from Cusabio (Wuhan, Hubei, China) and BD Biosciences (San Jose, CA, USA), respectively.

Techniques: Expressing, Translocation Assay

Journal: iScience

Article Title: FMRP-dependent translational control negatively regulates adapter protein complex 2-mediated endocytosis

doi: 10.1016/j.isci.2025.113062

Figure Lengend Snippet: FMRP negatively regulates the subcellular expression of AP-2 subunits (A) The subunits of three adapter protein complexes (AP1G1, AP2B1, and AP3D1), a postsynaptic marker (PSD95), a glial cell marker (GFAP), and GAPDH were examined in whole mouse brain lysates (INP) and synaptoneurosome (SNS) samples from mouse brain (postnatal day one). (B) Expression of PSD95, GFAP, and AP complexes in input (INP) and synaptoneurosomes (SNS). Signals were normalized to GAPDH. (C) AP-2 subunits, AP2A1 and AP2B1, in SNS samples prepared from eight pairs of WT and Fmr1 KO mouse brains are shown by western blot. (D) Expression levels of AP2A1 and AP2B1 in SNS samples from WT and Fmr1 KO mice. Data are represented as mean ± SEM. Unpaired t-test, N = 8, ∗ p < 0.05 and ∗∗ p < 0.01. (E) Representative images of cultured mouse cortical neurons (DIV12) from WT or Fmr1 KO mice. Immunofluorescence for AP2B1 overlaid with PSD95 and MAP2 to show the dendritic and synapse morphology. Enlarged boxes show dendritic segments of selected neurons. Scale bars, 40 μm. (F) Quantitative analysis of AP2B1 intensity and postsynaptic localization in soma and dendritic regions. Data are represented as mean ± SEM. Paired t-test, N = 3, ∗ p < 0.05 and ∗∗∗ p < 0.001.

Article Snippet: Ap2a1 TaqMan Gene Expression probe (Fam-MGB) , ThermoFisher , Assay ID: Mm00475919_m1.

Techniques: Expressing, Marker, Western Blot, Cell Culture, Immunofluorescence

Journal: iScience

Article Title: FMRP-dependent translational control negatively regulates adapter protein complex 2-mediated endocytosis

doi: 10.1016/j.isci.2025.113062

Figure Lengend Snippet: FMRP associates with Ap2a1 and Ap2b1 mRNAs and represses nascent protein translation (A) mRNA levels of Ap2a1 and Ap2b1 in WT and Fmr1 KO mouse brains. Gapdh mRNA was used as internal control. Data are represented as mean ± SEM. Unpaired t-test, N = 8. (B) FMRP eCLIP binding sites within the mRNA sequences of Ap2a1 and Ap2b1 in E13.5 mouse brains. The intact mRNA sequences of Ap2a1 and Ap2b1 , including their 3′UTR regions, are presented, with peaks indicating the read densities of predicted binding sites within these regions. Size-matched input (SMI) represents the background reading. (C) RNA-immunoprecipitation (RIP) of FMRP-mRNA complex from mouse brain lysates. Confirmation of FMRP immunoprecipitation by western blot. (D) qPCR analysis of FMRP-mRNA complexes. Both Ap2a1 and Ap2b1 mRNAs were detected by qPCR. Psd95 and Map1b mRNAs were used as positive controls and Gapdh mRNA as a negative control. Data are represented as mean ± SEM. Paired t-test, N = 3, ∗∗∗∗ p < 0.0001. (E) Newly synthesized AP2B1 was detected by puro-PLA. WT or Fmr1 KO cortical neurons were treated with puromycin for 5 min before fixation, and the puro-PLA signal show nascent synthesis of AP2B1 within the 5 min time frame. Scale bars, 20 μm. (F) Nascent synthesis of AP2B1 in the soma (left) and dendritic (right) regions of WT and Fmr1 KO neurons. Data are represented as mean ± SEM. Paired t - test, N = 4, ∗ p < 0.05.

Article Snippet: Ap2a1 TaqMan Gene Expression probe (Fam-MGB) , ThermoFisher , Assay ID: Mm00475919_m1.

Techniques: Control, Binding Assay, RNA Immunoprecipitation, Immunoprecipitation, Western Blot, Negative Control, Synthesized

Journal: BMC Cancer

Article Title: A combined blood based gene expression and plasma protein abundance signature for diagnosis of epithelial ovarian cancer - a study of the OVCAD consortium

doi: 10.1186/1471-2407-13-178

Figure Lengend Snippet: Gene list of the 27 genes from the three USC-models, corresponding Assay-on-Demand TaqMan ® probes, SAM-results from the second selection step, and coefficients of the final L1 penalized logistic regression model

Article Snippet: 115368 , AP2A1 , Hs00367123_m1 , yes , 0.15 , −0.199.

Techniques: Selection

Journal: BMC Cancer

Article Title: A combined blood based gene expression and plasma protein abundance signature for diagnosis of epithelial ovarian cancer - a study of the OVCAD consortium

doi: 10.1186/1471-2407-13-178

Figure Lengend Snippet: Gene names and functions of the 13 genes with mean log 2 expression fold changes (A) and six proteins with mean log 2 abundance values in controls, FIGO I/II patients, and FIGO III/IV patients (B)

Article Snippet: 115368 , AP2A1 , Hs00367123_m1 , yes , 0.15 , −0.199.

Techniques: Expressing, Activation Assay, Control

Journal: PLoS ONE

Article Title: MEX3C interacts with adaptor-related protein complex 2 and involves in miR-451a exosomal sorting

doi: 10.1371/journal.pone.0185992

Figure Lengend Snippet: A . Western blotting confirmed efficiency of the MEX3C and AP-2 siRNAs. MEX3C was detected 24 hours after siRNA transfection; the loading control was β-actin. AP-2 α and AP-2 μ2 were examined 84 hours after siRNA transfection (after EV collection). The loading control was GAPDH. The panel on the right shows the relative expression after normalized to loading control determined by densitometry. Results are representative of two independent experiments. B . Real-time PCR analysis of EV RNA expression after MEX3C or AP-2 inhibition. Because inhibiting AP-2 α or AP-2 μ, or AP-2 α and AP-2 μ in HEK293T cells showed similar effects, these data were combined. * indicates p<0.001 by Tukey's multiple comparison test following ANOVA. For miR-451a and miR-320a, N = 3; for the others, N = 2. C . MEX3C or AP-2 inhibition did not affect cellular miR-451a expression (N = 3). D . EV miR-451a was protected from RNase by membrane (N = 5). ***, p<0.0001 between protease K and RNase treated samples with and without NP40 pre-treatment, analyzed by Tukey's multiple comparison test following ANOVA. For B , C and D , means ± standard error (s.e.m.) are shown.

Article Snippet: Control siRNA against firefly luciferase (CUUACGCUGAGUACUUCGA), human AP2A1 siRNA (AAGAGCAUGUGCACGCUGGCCA), human AP2M1 siRNA (AAGUGGAUGCCUUUCGGGUCA) [ ] were synthesized by Eurofins MWG Operon LLC (Louisville, KY;, all contained a 3’ overhang of dTdT.

Techniques: Western Blot, Transfection, Control, Expressing, Real-time Polymerase Chain Reaction, RNA Expression, Inhibition, Comparison, Membrane

Journal: PLoS ONE

Article Title: MEX3C interacts with adaptor-related protein complex 2 and involves in miR-451a exosomal sorting

doi: 10.1371/journal.pone.0185992

Figure Lengend Snippet: A . siRNA-mediated MEX3C or AP-2 inhibition reduced miR-451a in exosome-enriched preparations. For AP-2 inhibition, siRNAs for AP2A1 and AP2M1 were transfected simultaneously. Shown are representative data from two independent transfections. B . DOX-induction inhibited MEX3C expression at the RNA level (N = 3). C . shRNA targeting the MEX3C coding region inhibited MEX3C expression from pFlag-MEX3C-1 after DOX-induction (N = 2). Co-transfected EGFP expression was used as the control for transfection efficiency and loading. D . DOX-induced MEX3C inhibition decreased exosomal miR-451a but not miR-320a expression (N = 3). For B and D , the mean ± s.e.m. are presented. *, ** and *** indicate p<0.05, 0.01 and 0.0001 when compared with control in Tukey’s multiple tests ( B ) and Bonferroni posttests ( D ).

Article Snippet: Control siRNA against firefly luciferase (CUUACGCUGAGUACUUCGA), human AP2A1 siRNA (AAGAGCAUGUGCACGCUGGCCA), human AP2M1 siRNA (AAGUGGAUGCCUUUCGGGUCA) [ ] were synthesized by Eurofins MWG Operon LLC (Louisville, KY;, all contained a 3’ overhang of dTdT.

Techniques: Inhibition, Transfection, Expressing, shRNA, Control

Journal: PLoS ONE

Article Title: MEX3C interacts with adaptor-related protein complex 2 and involves in miR-451a exosomal sorting

doi: 10.1371/journal.pone.0185992

Figure Lengend Snippet: A . HGS was efficiently inhibited by siRNA si-HGS-2 but not si-HGS-1 . Right: Expression as measured by densitometry (normalized with β-actin expression). Shown are representative results from two experiments. B . Inhibiting HGS expression failed to decrease exosomal miR-451a expression (N = 2). C . GW4869 significantly inhibited exosomal miR-451a expression (N = 3). The mean ± s.e.m. are shown. * indicates p<0.05 compared with DMSO control in Bonferroni posttests following ANOVA. D . Proposed model for AP-2/MEX3C interaction. At least two regions in MEX3C are necessary for its interaction with AP-2 complex. The red question mark indicates uncertainty whether the MEX3C/AP-2 interaction is direct or indirect; the black question mark indicates that the identities of the substrates ubiquitinated by MEX3C ring finger domain, and the proteins that directly bind microRNA, are unknown. E . Proposed role of MEX3C in ceramide-mediated miRNA exosomal sorting. MEX3C increases the association of microRNA to the endosome. ILV: intraluminal vesicles; MVB: multivesicular body; *: ceramide. It is unknown whether MEX3C itself is sorted into the ILVs, so MEX3C was not shown in ILVs.

Article Snippet: Control siRNA against firefly luciferase (CUUACGCUGAGUACUUCGA), human AP2A1 siRNA (AAGAGCAUGUGCACGCUGGCCA), human AP2M1 siRNA (AAGUGGAUGCCUUUCGGGUCA) [ ] were synthesized by Eurofins MWG Operon LLC (Louisville, KY;, all contained a 3’ overhang of dTdT.

Techniques: Expressing, Control

Journal: Cellular and Molecular Life Sciences

Article Title: Mechano-regulation by clathrin pit-formation and passive cholesterol-dependent tubules during de-adhesion

doi: 10.1007/s00018-023-05072-4

Figure Lengend Snippet:

Article Snippet: AP2A1 Rabbit mAb , Abclonal , Cat#A4403.

Techniques: Purification, Recombinant, Cell Culture, Modification, Saline, Transfection, Plasmid Preparation, Software

Journal: Autophagy

Article Title: AP2M1 mediates autophagy-induced CLDN2 (claudin 2) degradation through endocytosis and interaction with LC3 and reduces intestinal epithelial tight junction permeability

doi: 10.1080/15548627.2021.2016233

Figure Lengend Snippet: Interaction of CLDN2 with clathrin and autophagy apparatus. (A) Co-immunoprecipitation studies showed an increased association of CLDN2 with AP2M1, AP2A1, clathrin, LC3 during early starvation and lysosomal marker protein LAMP2 at the later 12-h time point. The negative control includes immunoprecipitation with control IgG. (B) Quantification of CLDN2 fraction associated with various clathrin and autophagy proteins, as shown in panel A. (C) Confocal immunofluorescence examination showed that, CLDN2 (green) migrated away from the cell membrane and increased cytoplasmic colocalization with clathrin (red) after starvation (yellow). White bar: 5 µm. (D) AP2M1 immunoprecipitates showed increased presence of CLDN2, LC3 and clathrin after starvation. Representation of ≥ 3 independent experiments.

Article Snippet: The primary antibodies used included anti-CLDN2 (Abcam, ab53032), anti-LC3 (Sigma, L7543), anti-AP2A1 (Gene Tex, GTX22807), anti-phospho-AP2M1 (Cell signaling Technologies, 73,995), anti-clathrin, anti-AP2M1, anti-ATG7, anti-ATG16L1, anti-SQSTM1/p62, anti-ACTB/β.

Techniques: Immunoprecipitation, Marker, Negative Control, Immunofluorescence