Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE Transfection and treatment of cortical neurons Neurons were transfected 7 to 9 days after plating using a high efficiency Ca 2+ -phosphate transfection method ( Jiang and Chen, 2006 ).

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software

Journal: Neurobiology of disease

Article Title: Identifying disulfidptosis-related biomarkers in epilepsy based on integrated bioinformatics and experimental analyses.

doi: 10.1016/j.nbd.2025.106789

Figure Lengend Snippet: Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted with NDUFA11, NUBPL, and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: The paraffin sections were incubated with the primary antibodies (overnight, 4 ◦C): anti-GYS1 antibody (Sangon Biotech, D122431, dilution: 1:100), anti-NDUFS1 antibody (Abcam, ab185733, dilution: 1:100), anti-OXSM antibody (Boster, A12866–1, dilution: 1:100), anti-LRPPRC antibody (Abcam, ab259927, dilution: 1:200), anti-NDUFA11 antibody (Abclonal, A16239, dilution: 1:100) (Yang et al., 2022), anti-NUBPL antibody (Boster, A10634–1, dilution: 1:100), anti-NCKAP1 antibody (Bioworld Technology, BS71703, dilution: 1:50), anti-SLC3A2 antibody (Santa, sc-390,154, dilution: 1:50), anti-SLC7A11 antibody (Abcam, ab307601. dilution: 1:500).

Techniques: Expressing, Control

Journal: Neurobiology of disease

Article Title: Identifying disulfidptosis-related biomarkers in epilepsy based on integrated bioinformatics and experimental analyses.

doi: 10.1016/j.nbd.2025.106789

Figure Lengend Snippet: Fig. 8. The expression of DE-DRMs in seizures models (in vitro and in vivo). (A) Constructing the in vitro seizures model. The amplitude and frequency of neuronal APs in the Mg2+-free group were significantly increased (n = 6 in each group; Independent sample t-test; #, P < 0.01). (B) Protein expression of nine DE-DRMs in the in vitro seizures model. The expression of GYS1, NDUFS1, OXSM, LRPPRC, NDUFA11, NUBPL, NCKAP1, and SLC3A2 were not significantly changed in the Mg2+-free group, while the expression of SLC7A11 was significantly increased in Mg2+-free group (n = 6 in each group; Independent sample t-test; #, P < 0.01). (C) Con structing the in vivo seizures model. No epileptoid discharges were observed in six rats of the Ctrl group, while significant epileptoid discharges were observed in six rats of the PTZ group (scale: Y-axis,50uV; X-axis, 0.5 s). (D) Protein expression of nine DE-DRMs in vivo models. The expressions of GYS1, NDUFS1, OXSM, LRPPRC, NDUFA11, NUBPL, NCKAP1, and SLC3A2 were not significantly changed in PTZ group, while the expression of SLC7A11 was significantly increased in PTZ group (n = 6 in each group; Independent sample t-test; #, P < 0.01). Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; APs, action potentials; GYS1, glycogen synthase 1; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; OXSM, 3-oxoacyl-ACP synthase, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; NCKAP1, NCK associated protein 1; PTZ, pentylenetetrazol.

Article Snippet: The paraffin sections were incubated with the primary antibodies (overnight, 4 ◦C): anti-GYS1 antibody (Sangon Biotech, D122431, dilution: 1:100), anti-NDUFS1 antibody (Abcam, ab185733, dilution: 1:100), anti-OXSM antibody (Boster, A12866–1, dilution: 1:100), anti-LRPPRC antibody (Abcam, ab259927, dilution: 1:200), anti-NDUFA11 antibody (Abclonal, A16239, dilution: 1:100) (Yang et al., 2022), anti-NUBPL antibody (Boster, A10634–1, dilution: 1:100), anti-NCKAP1 antibody (Bioworld Technology, BS71703, dilution: 1:50), anti-SLC3A2 antibody (Santa, sc-390,154, dilution: 1:50), anti-SLC7A11 antibody (Abcam, ab307601. dilution: 1:500).

Techniques: Expressing, In Vitro, In Vivo

Journal: Neurobiology of disease

Article Title: Identifying disulfidptosis-related biomarkers in epilepsy based on integrated bioinformatics and experimental analyses.

doi: 10.1016/j.nbd.2025.106789

Figure Lengend Snippet: Fig. 9. Verifying the PPI in seizures models (in vivo and in vitro). (A-B) colocation analysis indicated that SLC7A11 colocalized with SLC3A2, NDUFS1 colocalized with LRPPRC, NDUFS1 colocalized with NUBPL, and NDUFS1 colocalized with NDUFA11 in both primary neurons and hippocampal tissue. (C–D) Pooled quan tification of protein immunoprecipitation showed a significant increment in the pull-down of SLC7A11 and a significant reduction in the pull-down of NDUFA11 in both the Mg2+-free group and PTZ group (n = 6 in each group; Independent sample t-test; #, P < 0.01). Abbreviations: PPI, protein-protein interaction; SLC3A2,solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; LRPPRC, leucine rich pentatricopeptide repeat containing; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; PTZ, pentylenetetrazol.

Article Snippet: The paraffin sections were incubated with the primary antibodies (overnight, 4 ◦C): anti-GYS1 antibody (Sangon Biotech, D122431, dilution: 1:100), anti-NDUFS1 antibody (Abcam, ab185733, dilution: 1:100), anti-OXSM antibody (Boster, A12866–1, dilution: 1:100), anti-LRPPRC antibody (Abcam, ab259927, dilution: 1:200), anti-NDUFA11 antibody (Abclonal, A16239, dilution: 1:100) (Yang et al., 2022), anti-NUBPL antibody (Boster, A10634–1, dilution: 1:100), anti-NCKAP1 antibody (Bioworld Technology, BS71703, dilution: 1:50), anti-SLC3A2 antibody (Santa, sc-390,154, dilution: 1:50), anti-SLC7A11 antibody (Abcam, ab307601. dilution: 1:500).

Techniques: In Vivo, In Vitro, Immunoprecipitation