|
Thermo Fisher
gene exp ank2 mm00618325 m1 Gene Exp Ank2 Mm00618325 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Gene+Exp%2E+Ank2%2C+Mm00618325_m1/pm25489988__41467_2014_BFncomms6705_MOESM1296_ESM-173-45--1 Average 87 stars, based on 1 article reviews
gene exp ank2 mm00618325 m1 - by Bioz Stars,
2026-09
87/100 stars
|
Buy from Supplier |
|
OriGene
ggttcctgagtcgtatcgcgta Ggttcctgagtcgtatcgcgta, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Ankyrin+brain+(ANK2)+Human+qPCR+Primer+Pair/pm40359940-212-110-111 Average 93 stars, based on 1 article reviews
ggttcctgagtcgtatcgcgta - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
stressmarq
smc-400 Smc 400, supplied by stressmarq, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Anti-Ankyrin+B+Antibody/pmc10272139-1-0-4 Average 91 stars, based on 1 article reviews
smc-400 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ank2 hs00153998 m1 Gene Exp Ank2 Hs00153998 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Gene+Exp%2E+ANK2%2C+Hs00153998_m1/pmc03597452-223-33--1 Average 86 stars, based on 1 article reviews
gene exp ank2 hs00153998 m1 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Ribobio co
small interfering rna (sirna) duplex against pln or ank2 Small Interfering Rna (Sirna) Duplex Against Pln Or Ank2, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/small+interfering+rna++sirna++duplex+against+pln+or+ank2/pm31507414-87-15-21 Average 90 stars, based on 1 article reviews
small interfering rna (sirna) duplex against pln or ank2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ImmunoWay Biotechnology Company
ank2 Ank2, supplied by ImmunoWay Biotechnology Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/ank2+antibody/pm39540264-333-64-65 Average 90 stars, based on 1 article reviews
ank2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
ank2 variants Ank2 Variants, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/ank2+variants/pmc05712256-100-12-22 Average 90 stars, based on 1 article reviews
ank2 variants - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
SCHOTT
lqts-associated mutation in ank2 Lqts Associated Mutation In Ank2, supplied by SCHOTT, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/human+ank2+variants/pm19862833-190-2-30 Average 90 stars, based on 1 article reviews
lqts-associated mutation in ank2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ClinGen Resource
ank2 brugada syndrome ![]() Ank2 Brugada Syndrome, supplied by ClinGen Resource, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/ank2+brugada+syndrome/pmc09743411-36-68-92 Average 90 stars, based on 1 article reviews
ank2 brugada syndrome - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Abnova
ank2 s105-17 antibody ![]() Ank2 S105 17 Antibody, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/ank2+s105+17+antibody/pm34294919-452-44-46 Average 90 stars, based on 1 article reviews
ank2 s105-17 antibody - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Current opinion in genetics & development
Article Title: Genetics of Congenital Arrhythmia Syndromes: The Challenge of Variant Interpretation
doi: 10.1016/j.gde.2022.102004
Figure Lengend Snippet: ClinGen reappraisal of genes associated with inherited arrhythmia syndromes
Article Snippet: Table 1: ClinGen Class Long QT syndrome Brugada syndrome Catecholaminergic polymorphic VT Short QT syndrome Other Definitive KCNQ1, KCNH2, SCN5A, CALM1/2/3 SCN5A RYR2, CASQ2 (AR) , TRDN, TECRL KCNH2 CACNA1C (Timothy), KCNJ2 (Anderson-Tawil) Strong TRDN (AR) — — KCNQ1, SLC4A3 * KCNE1 (aLQTS), KCNE2 (aLQTS) Moderate CACNA1C — CASQ2(AD), CALM1/2/3 SLC4A3 * , KCNJ2 — Limited CAV3, KCNE1, KCNJ2 — — — — Disputed/ No evidence SNTA1, AKAP9,
Techniques: