Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) Sequence alignments of miR-122 with 3’UTR of AKT3 from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Sequencing, Luciferase, Reporter Assay, Expressing, Plasmid Preparation, Transfection, Construct, Activity Assay, Binding Assay

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) The AKT3 transcript level normalized to its expression in normal liver (right Y axis) and normalized miR-122 expression (left Y axis) were measured in various HCC cell lines. ( B ) The relative expression level of closely homologous isoforms AKT1 and AKT2 were measured in HCC cell lines. ( C ) Western blot analysis of total AKT and AKT3 protein levels in various HCC cell lines. Actin was used as the loading control in these studies.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Expressing, Western Blot, Control

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) AKT3 mRNA and protein levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone. The membrane blot of the Huh-7 cells required unusually long exposures before the AKT3 bands could be visualized. ( B ) AKT1 and AKT2 transcript levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Stable Transfection, Expressing, Membrane

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: These miR122 induced anti-tumor activities were rescued by ectopic expression of AKT3. ( A ) Cell migration assays were performed on SNU-182 or Huh-7 cells over-expressing miR-122 GFP or GFP alone. Migratory responses to the bottom chamber with and without addition of stimulator (10% HGF) are shown. ( B ) Cell migration assays were performed using miR-122-GFP or GFP alone over-expressing SNU-182 cells with or without AKT3 reconstitution. ( C ) Phosphorylation of BAD, total BAD level and cleaved caspase 3 were measured in SNU-182 and Huh-7 cells over-expressing miR-122-GFP or GFP alone. ( D ) Transient reconstitution effects of AKT3 in SNU-182 cells over-expressing miR-122-GFP or GFP alone were also measured. Statistical significance between the indicated groups is depicted as *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Expressing, Migration, Phospho-proteomics

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: Cell proliferation was measured in (A) SNU-182 and (C) Huh-7 parental cells and cells stably over-expressing miR-122-GFP or GFP alone. (B) Cell proliferation was measured in SNU-182 cells over-expressing miR-122-GFP or GFP with or without the reconstitution of AKT3 expression. (D) Nude mice were implanted with SNU-182 parental lines as well as cells over-expressing miR-122-GFP or GFP vector alone, and tumor growth was monitored and plotted as tumor volume (mm 3 ) over time. Statistical significance between the indicated groups are depicted as ** P <0.01, and *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Stable Transfection, Expressing, Plasmid Preparation

Journal: Physiological reports

Article Title: AKT2 is the predominant AKT isoform expressed in human skeletal muscle.

doi: 10.14814/phy2.13652

Figure Lengend Snippet: Figure 1. RNA transcript and protein expression of AKT isoforms in human skeletal muscle. Real-time PCR was performed on cDNA derived from human vastus lateralis using AKT isoform-specific primers/probes. Expression levels are normalized to expression of AKT1 which was set to 1.0. (means SEMs; n = 4; ***, P < 0.001 versus AKT1 and AKT3). (B) Western immunoblotting was performed on synthetic peptides of full- length human AKT1, AKT2, or AKT3 using the indicated antibodies. (C) Immunoprecipitations were performed using either rabbit or mouse pan AKT antibodies followed by western blotting with isoform-specific antibodies as indicated. Twenty-five micrograms of whole cell lysate (“WCL”) were also subjected to SDS-PAGE. Control immunoprecipitations were performed using the relevant species-specific IgG instead of antibody. Molecular mass in kDa is shown on the left of each blot. “HC;” heavy chain; LC, light chain.

Article Snippet: Antibodies for AKT1 (C73H10; #2938), AKT2 (D6G4; #3063), AKT3 (E2B6R; #14293), AKT (Pan) (C67E7) (rabbit monoclonal; #4691), AKT (Pan) (40D4) (mouse monoclonal; #2920), and Protein A HRP (#12291S), were purchased from Cell Signaling Technologies (Danvers, MA).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Derivative Assay, Western Blot, SDS Page, Control

Journal: Journal of Virology

Article Title: Specific Akt Family Members Impair Stress-Mediated Transactivation of Viral Promoters and Enhance Neuronal Differentiation: Important Functions for Maintaining Latency

doi: 10.1128/jvi.00901-20

Figure Lengend Snippet: Figure 4. Akt3 efficiently promotes neurite formation in Neuro-2A cells. 730

Article Snippet: A plasmid that expresses Akt3 was a gift from William Sellers (1236 320 pcDNA3 Myr HA Akt3; plasmid 9017; Addgene).

Techniques:

Journal: Scientific Reports

Article Title: Inhibition of AKT1 signaling promotes invasion and metastasis of non-small cell lung cancer cells with K-RAS or EGFR mutations

doi: 10.1038/s41598-017-06128-9

Figure Lengend Snippet: Upregulation of LAMC2 is required for migration and invasion resulting from AKT1 inhibition. Expression of LAMC2 and the phospho- and total AKT in ( a ) PC-9 cells treated with the indicated concentration of MK2206 for 24 hours, ( b ) PC-9 cells treated with 1 µM MK-2206 for the indicated times, and ( c ) A549, and H1975 cells treated with the indicated concentrations of MK-2206 for 24 hours. ß-actin was also detected for loading controls. ( d ) Western blot detection of LAMC2 and AKT1 in H358, PC-9 and H838 cells transfected with three distinct AKT1 siRNAs (10 nM) for 48 hours. Migration and invasion of ( e ) PC-9 cells transfected with LAMC2 shRNA with/without AKT1 siRNA treatment for 48 hours and ( f ) PC-9 cells with/without LAMC2 shRNA and/or 1 μM MK-2206 for 24 hours. *** P < 0.001. ( g ) Western blot analysis of LAMC2 and the phospho- and total proteins of AKT1 in A549, H2122, H838 and H1703 cells stably transfected with LAMC2 expression vector, or in PC-9 and H358 cells infected with shLAMC2 lentiviral expression vector.

Article Snippet: AKT2 siRNAs (sc-29197), AKT3 siRNA (sc-38911) and MARCKS siRNAs (sc-35857) were purchased from Santa Cruz.

Techniques: Migration, Inhibition, Expressing, Concentration Assay, Western Blot, Transfection, shRNA, Stable Transfection, Plasmid Preparation, Infection

Journal: Scientific Reports

Article Title: Inhibition of AKT1 signaling promotes invasion and metastasis of non-small cell lung cancer cells with K-RAS or EGFR mutations

doi: 10.1038/s41598-017-06128-9

Figure Lengend Snippet: AKT1 inhibition activates MARCKS to promote migration and invasion. Heat map of proteins with significant changes in the RPPA assays of A549, PC-9, H838 and H3122 treated with vehicle or ( a ) 1 μM MK-2206 for 24 hours or ( b ) 10 nM AKT1 siRNA pool for 48 hours. Relative protein levels are color-coded: low (green), median (black), and high (red). Western blot analysis of phospho-MARCKS and other indicated proteins in ( c ) A549 cells and ( d ) PC-9 cells treated with AKT1 siRNA or MK-2206 with/without MARCKS siRNA. ( e ) Migration and invasion assays of A549 cells treated with AKT1 siRNAs or MK-2206 with/without MARCKS siRNAs.

Article Snippet: AKT2 siRNAs (sc-29197), AKT3 siRNA (sc-38911) and MARCKS siRNAs (sc-35857) were purchased from Santa Cruz.

Techniques: Inhibition, Migration, Western Blot

Journal: Clinical Cancer Research

Article Title: Targeting Akt3 Signaling in Malignant Melanoma Using Isoselenocyanates

doi: 10.1158/1078-0432.ccr-08-2214

Figure Lengend Snippet: Fig. 1. siRNA-mediated inhibition of Akt3 expression/activity inhibits melanoma tumor development. A, siRNA (100 pmoles) against Akt3 (E), scrambled siRNA (5), or nucleofection buffer (o) were introduced into UACC 903 (1 106) melanoma cells and 36 h later viable cells were injected s.c. into nude mice. Result shows that reduced expression/activity of Akt3 decreases the tumorigenic potential of melanoma cells by f60% compared with control cells nucleofected with scrambled siRNA or nucleofection buffer (one-wayANOVA, P < 0.0001); error bars, SE. B, Western blot and quantitation analysis of tumor protein lysates harvested 9.5 d after cells were nucleofected and s.c. injected into animals. Decreased Akt3 protein expression was observed in tumors confirming siRNA-mediated inhibition. a-Enolase served as a control for protein loading. C, siRNA-mediated knockdown of Akt3 protein persists up to 8 d in cultured cells. One million UACC 903 cells were nucleofected with 100 pmoles of siAkt3 and replated in culture dishes, and protein lysates harvested 2, 4, 6, and 8 d later forWestern blot analysis to determine Akt3 protein levels in cells. Decreased Akt3 protein expression compared with controls was observed up to 8 d after nucleofection into cells. a-Enolase served as a control for protein loading onWestern blots, whereas scrambled siRNA served as a control for RNA interference specificity.

Article Snippet: Blots were probed with antibodies according to each supplier’s recommendations: phosphorylated-PRAS40 (Thr246) from Invitrogen; phosphorylated Akt (Ser473), Akt3, and cleaved PARP from cell signaling; Erk2, a-enolase, and secondary antibodies conjugated with horseradish peroxidase from Santa Cruz Biotechnology; and Immunoblots were developed using the enhanced chemiluminescence detection system (Pierce Biotechnology).

Techniques: Inhibition, Expressing, Activity Assay, Injection, Control, Western Blot, Quantitation Assay, Knockdown, Cell Culture

Journal: Clinical Cancer Research

Article Title: Targeting Akt3 Signaling in Malignant Melanoma Using Isoselenocyanates

doi: 10.1158/1078-0432.ccr-08-2214

Figure Lengend Snippet: Fig. 5. Inhibition of Akt3 signaling mediated by isoselenocyanates induces apoptosis in melanoma cells. A, Western blot analysis of cells treated with ISC-4 or ISC-6 show decreased Akt3 signaling. Melanoma cells (UACC 903,1205 Lu, orWM115) were exposed for 24 h to increasing concentrations (2.5-15 Amol/L) of ISC-4 or ISC-6 and compared with PBITC, PHITC, or DMSO.Western blot analysis measuring activity of theAkt3 signaling pathway shows dose-dependent decrease in pAkt (S473), downstream pPRAS40 (T246), and increase in cleaved poly (ADP-ribose) polymerase, indicating increased cellular apoptosis. Erk2 served as control for equal protein loading. B, ISC-4 decreases Akt3 signaling in1205Lu andWM115 melanoma cell lines.Western blot showing effect of ISC-4 treatment on Akt3 activity in1205 Lu andWM115 cells. ISC-4 decreases pAkt levels and increases cellular apoptosis levels as indicated by elevated cleaved poly (ADP-ribose) polymerase protein. Erk2 served as a control for equal protein loading. C, ISC-4 decreases pAkt and downstream pPRAS40 levels in tumors. Densitometric quantitation ofWestern blot analysis of tumor protein lysates from animals treated with PBITC or ISC-4 and compared with DMSO vehicle treatment shows decreased relative expression of pAkt and downstream pPRAS40 normalized against a-enolase indicating decreased Akt3 signaling in tumors following treatment (one-wayANOVA, ***P < 0.001; * P < 0.05); error bars, SE.

Article Snippet: Blots were probed with antibodies according to each supplier’s recommendations: phosphorylated-PRAS40 (Thr246) from Invitrogen; phosphorylated Akt (Ser473), Akt3, and cleaved PARP from cell signaling; Erk2, a-enolase, and secondary antibodies conjugated with horseradish peroxidase from Santa Cruz Biotechnology; and Immunoblots were developed using the enhanced chemiluminescence detection system (Pierce Biotechnology).

Techniques: Inhibition, Western Blot, Activity Assay, Control, Quantitation Assay, Expressing