Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: Leptin upregulates MTA1 expression in human breast cancer cells. MTA1 mRNA expression was analyzed using qPCR in MDA-MB-231 ( A ) and Hs 578T cells ( B ) after leptin treatment for 24 h. Results are expressed as mean ± SD; * p < 0.05 and ** p < 0.01 vs. untreated control. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( C ) and Hs 578T cells ( D ) after 24 h of leptin treatment.

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Expressing, Control, Western Blot

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: Leptin upregulates MTA1 expression via the Ob-R/STAT3 pathway in human breast cancer cells. MTA1 protein expression was evaluated using Western blot in MDA-MB-231 ( A , C ) and Hs 578T cells ( B , D ) after 24 h of leptin treatment in the presence or absence of Ob-R BP ( A , B ) or AG490 ( C , D ).

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Expressing, Western Blot

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: MTA1 overexpression promotes VM in human breast cancer cells. MDA-MB-231 ( A , C , E ) and Hs 578T cells ( B , D , F ) were transfected with the MTA1 CRISPR activation plasmid for 48 h. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( A ) and Hs 578T cells ( B ). VM was performed using a 3D culture assay for 16 h in MDA-MB-231 ( C ) and Hs 578T cells ( D ) (40× magnification; scale bar = 500 μm). Results are expressed as mean ± SD; *** p < 0.001 vs. control plasmid. Expression of VM-related proteins was evaluated using Western blot in MDA-MB-231 ( E ) and Hs 578T cells ( F ).

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Over Expression, Transfection, CRISPR, Activation Assay, Plasmid Preparation, Expressing, Western Blot, Control

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: MTA1 silencing inhibits leptin-induced VM in human breast cancer cells. MDA-MB-231 ( A , C , E ) and Hs 578T cells ( B , D , F ) were treated with leptin 48 h after transfection with MTA1 siRNA. MTA1 protein expression was evaluated using Western blot in MDA-MB-231 ( A ) and Hs 578T cells ( B ). VM was performed using a 3D culture assay for 16 h in MDA-MB-231 ( C ) and Hs 578T cells ( D ) (40× magnification; scale bar = 250 μm). Results are expressed as mean ± SD; *** p < 0.001 vs. untreated control; ### p < 0.001 vs. control siRNA. Expression of VM-related proteins was evaluated using Western blot in MDA-MB-231 ( E ) and Hs 578T cells ( F ).

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Transfection, Expressing, Western Blot, Control

Journal: Genome Biology

Article Title: Pamoic acid and carbenoxolone specifically inhibit CRISPR/Cas9 in bacteria, mammalian cells, and mice in a DNA topology-specific manner

doi: 10.1186/s13059-025-03521-w

Figure Lengend Snippet: The effect of inhibitors on suppressing the genome editing on SSEA locus by Spy Cas9 or Sau Cas9 in bacteria. A The schematic diagram of two-plasmid-based bacterial survival assay for detecting the activity of Spy Cas9 in bacteria. pCas plasmid (Addgene #62225,Additional file 1: Table S2) was transformed into the E. coli MG1655 before an electroporation with pTarget plasmids coding for sgRNA targeting SSEA (pT-sg SSEA , Additional file 1: Table S4) or empty vector (pT-sg Control ; pTargetF, Addgene #62226). Then, the effect of compounds was evaluated by counting the number of survival colonies (see the “ ” section). B The effect of Cas9 inhibitors on the activity of Spy Cas9 in the two-plasmid-based bacterial survival assay. Compounds were incubated with the electroporated bacteria ( A ) for 1.5 h at 32 °C before spreading on LB plates with kanamycin and spectinomycin antibiotics. After an overnight incubation, the image of cultured plate was taken (Additional file 1:Fig.S7D), and the number of colonies (indicated below the plate image) was quantified with a Colony Counter software (Tanon, China), and expressed as the percentages of their respective control at the same concentration (the pT-sg Control electroporated strain treated with the compound, 100%; Additional file 1:Fig.S7D). Means ± SDs ( n = 3, biological replicates). Statistical analyses were performed using two-way ANOVA with Bonferroni posttests; *p < 0.05; **p < 0.01; *** p < 0.001. C The schematic diagram of the genome editing assay for monitoring the activity of Spy Cas9 or Sau Cas9 in the presence of homologous repair template DNA and in bacteria. pCas plasmid was first transformed into MG1655 strain before an electroporation to pTarget plasmids carrying a pair of homologous repair template DNA that is missing the 1-243 bp of SSEA gene (see the “ ” section) and a coding sequence for Spy Cas9 or Sau Cas9 sgRNA (pT-sg SSEA (867 bp)). Then, the E. coli cells were incubated with the compounds before genotyping with PCR for analyzing the efficiency of genome editing at the SSEA . 909 bp, the size of PCR product from a strain, in which 1-243 bp of SSEA is missing; 1152 bp, the size of PCR product from a strain with wt SSEA gene. D The effect of Cas9 inhibitors on the genome editing activity of Spy Cas9 (left panel) or Sau Cas9 (right panel) in the presence of a homologous recombination repair template. Compounds were incubated with the electroporated bacteria ( C ) for 20 h at 32 °C, and the SSEA in the treated bacteria was amplified with PCR and analyzed on a 1% agarose. The original images for PCR-based genome typing were shown in the Additional file 1:Fig.S8B. Means ± SDs ( n = 3, biological replicates). The ddH 2 O (for dalbavancin or carbenoxolone) or DMSO (pamoic acid or epirubicin) treated groups, 100%. Statistical analysis was performed using one-way ANOVA with Tukey’s multiple comparisons test; *** p < 0.001. All experiments were independently repeated at least twice, and representative results are presented

Article Snippet: Similarly, pTarget-sg SSEA (867 bp)- Sau was constructed by cloning a pair of annealed oligonucleotides encoding a 21-bp spacer of sg SSEA (No. 37–38, Additional file 1: Table S3-4) at the SapI site in a plasmid, which was assembled with the PCR products from pX601 miniCMV-SaCas9 (Addgene, #107,055, Additional file 1: Table S2; a gift from Dr. Alex Hewitt, School of Medicine, University of Tasmania) and pTargetF (867 bp) by using Seamless Assembly (No. 39–42, Additional file 1: Table S3).

Techniques: Bacteria, Plasmid Preparation, Clonogenic Cell Survival Assay, Activity Assay, Transformation Assay, Electroporation, Control, Incubation, Cell Culture, Software, Concentration Assay, Sequencing, Homologous Recombination, Amplification

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), TET1 siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: Positive Control, Incubation, Gene Expression, Activity Assay, Expressing, Negative Control, Staining, Quantitation Assay

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: AKG-TET dependent resilience to damage and protection against damage-induced senescence Proliferating aHDFs (0.3 × 10 6 /mL) and PBMCs (70 years; PBMC 70Yr, 1 × 10 6 /mL) were seeded in culture plates and pre-treated in triplicate without (untreated: UT) or with H 2 O 2 (100 μM) for 24 h. After 24 h, cells were washed and treated without or with CLV (20 μM), or CRISPR TET1 ( TET1 CR ;1 μg/mL). Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Expression levels of TETs in PBMCs. (B) AKG bioavailability in PBMCs. (C) Expression levels of energy/stress and nutritional sensors in PBMCs. (D) Heatmap of senescence marker gene expression in PBMCs. (E) Level of extracellular lactic acid (LA) and SAβ-Gal activity in PBMCs. (F) Quantification of BrdU and ROS (qROS) in PBMCs. Bar and line graphs show the means ± SD. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 . Points are shown as empty and mean points as filled circles.

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: CRISPR, Incubation, Expressing, Marker, Gene Expression, Activity Assay

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: AKG-TET deficient senescence state is reversible Young replicatively proliferating aHDFs (week 3, 0.3 × 10 6 /mL)) were seeded in culture plates and pre-treated in triplicates without (UT) and with C35 (5 μM), RLS (20 μM), or TET1 siRNA ( TET1 i ; 300 nM). Aliquot of cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. The remaining cells were re-seeded in equal numbers and cultured without treatment for an additional 7 days (withdrawal). Cultures were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media. (A) Quantification of TET activity, and 5 mC and 5fc levels. (B) Expression level of energy/stress and nutritional sensor genes. (C) Expression level of NFKB1 , RELA , IKBA , COL1A1, and ELN . (D) γH2AX immunolocalized (cyan) in nuclei. Nuclei stained for DAPI (deep blue) are marked by double hashed lines. (E) Extracellular level of lactic acid (LA), SAβ-Gal activity, LDH toxicity, and UPS. (F) Intracellular level of ROS and 8OHdG. (G) Heatmap of senescence markers and RRM2 gene expression. (H) Rate of proliferation assessed by BrdU incorporation into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. All points are shown as empty, and mean points as filled circles. The distribution of all data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: Incubation, Cell Culture, Activity Assay, Expressing, Staining, Gene Expression, BrdU Incorporation Assay

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: Activation of the AKG-TET axis reverses replicative and age induced senescence Replicatively induced senescence. Replicatively senescent aHDFs (0.3 × 10 6 cells/mL) were seeded in triplicate in each plate and were treated without (UT) and with RLS (20 μM), CLV (20 μM), or CRISPR TET1 plasmids (TET1 CR , 1 μg/mL). Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Expression level of TET s. (B) AKG bioavailability and TET activity (TET act ). (C) Expression level of energy/stress and nutritional sensor gene expression. (D) Intracellular level of ROS. (E) Heatmap of senescence marker and RRM2 gene expression. (F) Level of lactic acid (LA) in culture media. (G) Cellular SAβ-Gal activity. (H) Quantitation of nuclear BrdU. (I) Total cell numbers. Age induced senescence. PBMCs (PBMC 70Yr ) were seeded (1 × 10 6 cells/mL) in triplicate in each well of a 24-well plate and were treated without (UT) and with RLS (20 μM), CLV (20 μM), or CRISPR TET1 plasmids ( TET1 CR : 1 μg/mL). Cells and culture media were removed on day 7 of treatment for analysis. (J) Quantitation of bioavailable AKG and TET activity in cells treated with RLS versus CLV. (K) qPCR quantitation of the expression level of TET s. (L) qPCR quantitation of the expression level of energy/stress and nutritional sensor gene expression. (M) Quantitation of BrdU incorporated into nuclei of cells in S-phase, lactic (LA) acid in culture media, cellular SAβ-Gal activity, and ROS. (N) Heatmap of senescence markers and RRM2 in PBMCs. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. All points are shown as empty, and mean points as filled circles. The distribution of all data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 , ∗∗∗∗p ≤ 5 × 10 −5 .

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: Activation Assay, CRISPR, Incubation, Expressing, Activity Assay, Gene Expression, Marker, Quantitation Assay

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: ( A ) A schematic representation of the transplantation of DPSC into the first molar tooth after drilling. ( B ) The confirmation of BDNF CRISPR activation plasmid enhanced the expression of pro-BDNF. ( C ) Bar graph showing the integrated intensity of CRISPR-engineered BDNF-activated DPSCs against β-actin compared to control. ( D ) H&E staining of sham control and injured tooth in mouse (n = 6 each group) transplanted with CRISPR-engineered BDNF-overexpressing DPSCs. Scale bar: 100 μm. Figure 4—source data 1. Original files for western blot images displayed in . Figure 4—source data 2. Original files for western blot images displayed in with labeling.

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Transplantation Assay, CRISPR, Activation Assay, Plasmid Preparation, Expressing, Control, Staining, Western Blot, Labeling

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: ( A ) Immunohistochemistry was performed to assess GFP-tagged transplanted cells. The white arrow indicates the pulp lining. Scale bar: 100 μm ( B ) Micro-CT image in the sham control of the pulp-capping mouse model. The white arrow indicates the drilling operation, and the dotted line specifies the injured area of dentin. The white box is a magnified image of the injured area. ( C ) The transplantation of CRISPR-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model. ( D ) Analyzed density of dentin compared with sham control vs. transplantation of CRISPR-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model (n=5). p<0.05 vs. control.

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Immunohistochemistry, Micro-CT, Control, Transplantation Assay, CRISPR

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: ( A ) Representative image of sham control of the pulp-capping mouse model. ( a–j ) Sham control vs. ( k–t ) representative image of the transplantation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model. Scale bars: 25 and 50 μm. ( B ) Line graphs showing the co-localization of BDNF and GFP [B (e1 and j1)] and of TrkB and GFP [B (o1 and t1)].

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Control, Transplantation Assay, CRISPR

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: Proposed interaction of tumor necrosis factor alpha (TNFα) and brain-derived neurotrophic factor (BDNF)/tropomyosin receptor kinase B (TrkB) downstream signaling to modulate odontoblastic differentiation in dental pulp stem cells (DPSCs).

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Derivative Assay

Journal: MedComm

Article Title: Therapeutic Effects of Noninvasive Electrical Stimulation in Combination Transplantation of Human Adipose‐Derived Stem Cells‐Derived Dopaminergic Neuron on the Monkey Model of Parkinson's Disease

doi: 10.1002/mco2.70595

Figure Lengend Snippet: NES and NES‐DN attenuate the immune response by lowering SERPINA3. (A) RNA seq analysis revealed changes in 48 genes coregulated by NES and NES‐DN treatments, as shown in the Venn diagram. (B) Western blot results of SERPINA3 in putamen. C, Quantitative statistical results of changes in SERPINA3 protein levels. WT ( n = 3), MPTP ( n = 3), NES ( n = 2), and NES‐DN ( n = 3), **** p < 0.001. (D) STRING analysis shows that SERPINA3 can regulate IL‐6 and IL‐1β. (E and F) QPCR results display IL‐6 (E) and IL‐1β (F) RNA quantification statistical chart. (G) RNA seq analysis reveals a heatmap of immune related gene changes in MPTP monkeys after treatment. (H) Western blot results of immune related proteins in putamen. (I–K) Quantitative statistical results of changes in immune related protein levels of IL6 (I), TNF‐α (J), p‐p65/p65 (K). WT ( n = 3), MPTP ( n = 3), NES ( n = 2), and NES‐DN ( n = 3), * p < 0.05, ** p < 0.01, *** p < 0.005.

Article Snippet: Primary antibodies were used: TH (Invitrogen; PA5‐85167), Vinculin (Sigma; MAB3574), GAPDH (Proteintech; 60004‐1‐Ig), MNF1 (abcam; ab126575), MNF2 (CST; 9482S), OPA1 (CST; 80471S), DRP1 (abcam; ab56788), Fis1 (CST; 32525S), NeuN (abcam; ab177487), PSD95 (CST; 2507S), synapsin‐1 (CST; 5297S), synaptophysin (CST; 25056S), Iba1 (abcam; ab178846), GFAP (Invitrogen; 13‐0300), SERPINA3 (Proteintech; 12192‐1‐AP), NF‐kB p65 (CST; 8242S), IL6 (abcam; ab233551), and TNF‐a (CST; 3707S).

Techniques: RNA Sequencing, Western Blot

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) DUSP22 expression in aged individuals (over 70 years, n = 15) and aged individuals diagnosed with sarcopenia (over 70 years, n = 18), p = 0.0009 (obtained from the Singapore Sarcopenia Study; (GEO accession no. GSE111016 (Migliavacca et al, )). ( B ) DUSP22 expression in C2C12 murine myotubes treated with vehicle or dexamethasone (Dex) to induce atrophy ( n = 3 each) Custer 1 ( p = 0.024), Cluster 2 ( p = 0.13), Cluster 3 ( p = 0.0246). Expression was measured using RNA Seq. TPM=transcript per million. ( C ) qPCR analysis of DUSP22 expression in four models of muscle atrophy: (1) C2C12 myotubes treated with Dex ( n = 5), p = 7.67E−05, (2) the TA muscle of C57BL/6 mice treated with Dex ( n = 4), p = 0.09, (3) the TA muscle of young (5 months-old, n = 9) and geriatric (27 months-old, n = 8) C57BL/6 mice, p = 0.0324, (4) the TA of C57BL/6 mice after hind limb immobilization ( n = 3), p = 0.018. ( D ) qPCR of DUSP22 expression in C2C12 myoblasts transfected with a DUSP22 CRISPR activation plasmid (DUSP22 endo OE) or control plasmid (CON endo OE) ( n = 3), p = 0.0022. ( E ) Fast myosin (MYH2) immunocytochemistry of CON endo OE and DUSP22 endo OE myoblasts after 96 h culture in DM (scale bar = 100 µm). ( F ) Fusion index ( n = 6). ( G ) Differentiation index ( n = 6), p = 9.91E−09. ( H – L ) qPCR analysis of gene expression related to the following: ( H ) Mitochondrial homeostasis (PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha, p = 1.44E−05), UCP-3 (mitochondrial uncoupling protein 3, p = 4.61E−05), Acly (ATP citrate lyase, p = 0.5141)) ( n = 4). ( I ) Autophagy (LC-3B (microtubule-associated proteins 1 A/1B light chain 3B, p = 0.0152), CtsL (cathepsin L, p = 4.76E−05)) ( n = 4). ( J ) Ubiquitin-proteasome system (UPS) (UBR2 (ubiquitin protein ligase E3, p = 0.0031), Psmd11 (proteasome 26S subunit, non-ATPase 11, p = 0.1718) ( n = 4). ( K ) Myosin heavy chain levels (slow myosin MYH7, p = 7.23E−06, fast myosin MYH1, p = 0.0171) ( n = 4), and ( L ) FoxO3a-related signaling (FoxO3a ( p = 0.0004), MurF-1 ( p = 0.0019), atrogin-1 ( p = 0.001), p62 ( p = 8.67E−08), TGIF (TGFB induced factor homeobox 1, p = 0.0001), ATF4 (activating transcription factor 4, p = 0.3974), Bnip3 (BCL2/adenovirus E1B 19 kDa protein-interacting protein 3, p = 0.0887); Gadd45a (growth arrest and DNA damage inducible alpha, p = 4.19E−06), SMART (specific of muscle atrophy and regulated by transcription, p = 0.0006), MUSA1 (muscle ubiquitin ligase of SCF complex in atrophy-1, p = 0.2357)) ( n = 4). Box plots represent the distribution of DUSP22 expression levels. The center line indicates the median (50th percentile, Q2), representing the middle value of the dataset. The box bounds correspond to the interquartile range (IQR), extending from the 25th percentile (Q1, lower bound) to the 75th percentile (Q3, upper bound). Whiskers extend to the smallest and largest values within 1.5 × IQR from Q1 and Q3, representing the minimum (lower whisker) and maximum (upper whisker) values within this range. Data points that fall beyond this range are considered outliers and are displayed as individual points outside the whiskers. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Expressing, RNA Sequencing, Transfection, CRISPR, Activation Assay, Plasmid Preparation, Control, Immunocytochemistry, Gene Expression, Ubiquitin Proteomics, Whisker Assay

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A , B ) Expression array profiling of DUSP22, MuRF-1, atrogin-1, and UBR2 expression levels (VST) in a database obtained from muscle biopsies, analyzed using Correlation AnalyzeR. ( C ) qPCR analysis of DUSP22 ( p = 7.22E−09), UBR2 ( p = 0.25), MuRF-1 ( p = 0.0101), atrogin-1 ( p = 0.0005) expression in C2C12 myotubes cultured treated with DM and control siRNA or DUSP22 siRNA for 48 h ( n = 5). ( D ) Fast myosin (MYH2) immunocytochemistry of C2C12 myoblasts cultured as follows: (1) 120 h incubation with DM; (2) 72 h incubation with DM and 48 h incubation with DM plus control, DUSP22 siRNA; (3) Following 72 h incubation with DM, 24 h incubation in with DM plus control, scrambled siRNA and additional 24 h treatment with 10 μM Dex plus siRNA; (4) Following 72 h incubation with DM, 24 h incubation in with DM plus DUSP22 siRNA and additional 24 h treatment with 10 μM Dex plus siRNA (scale bar = 100 μm). ( E ) Myotube diameter ( n = 4, p = siCON (3.01E−05), siDUSP22+Dex (0.0003)). ( F ) Myotube distribution. ( G ) Differentiation index of C2C12 myoblasts treated as in part ( D ) ( n = 4, p = siCON (0.0068), siDUSP22+Dex (0.0037))). ( H ) Fusion index ( n = 4). * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Expressing, Cell Culture, Control, Immunocytochemistry, Incubation

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Western blot analysis of FoxO3a and Akt phosphorylation in C2C12 myotubes treated with control or DUSP22 siRNA in the presence or absence of Dex. ( B ) Quantification of FOXO3a phosphorylation, which is inversely proportional to activity ( n = 6, p-FOXO3A/FOXO3A p =siDUSP22 (7.8E−05), siCON (0.0002), siDUSP22+Dex (0.018), FOXO3A p = siDUSP22 (3.37E−05), siCON (0.0024), siDUSP22+Dex (0.0013)). ( C ) Quantification of Akt phosphorylation, which is directly proportional to activity ( n = 6, p-AKT/AKT p = siDUSP22 (7.8E−05), siCON (0.0002), siDUSP22+Dex (0.018)). ( D ) qPCR analysis of atrogin-1 ( p = siDUSP22 (0.0187), siCON (0.0002), siDUSP22+Dex (0.0451)), MuRF-1 ( p = siDUSP22 (0.0037), siCON (0.0001), siDUSP22+Dex (0.0044)), and DUSP22 ( p =siDUSP22 (1.8E−05), siCON (0.0067), siDUSP22+Dex (2.91E−05)) expression ( n = 6,3). ( E ) Western blot of atrogin-1 and MuRF-1 expression levels. ( F ) Quantification of atrogin-1 ( p = siDUSP22 (0.0125), siCON (0.5.05E−09), siDUSP22+Dex (0.0003)), MuRF-1 ( p = siDUSP22 (0.0226), siCON (0.0033), siDUSP22+Dex (0.0098)), and DUSP22 ( p = siDUSP22 (0.0023), siCON (0.0356), siDUSP22+Dex (0.0353)) levels ( n = 5). ( G ) Fast-type myosin immunostaining of C2C12 myoblasts after culture in DM for 24 h and treatment with control, scrambled siRNA or DUSP22 siRNA for 72 h. Quantification of the fast-type myosin positive myotubes is also shown ( n = 5, p = 0.0001). ( H ) qPCR analysis of DUSP22 ( p = 0.0065), myosin heavy chains (slow myosin MYH7 ( p = 0.0004), fast myosin MYH2 ( p = 0.0024), fast myosin MYH1 ( p = 0.002), and fast myosin MYH4 ( p = 0.0002)), myogenin (MyoG) ( p = 0.0005) and FOXO3a ( p = 0.0171) expression ( n = 3). ( I ) Western blot analysis of MYH2 ( p = 0.015), p-JNK ( p = 0.0316), c-jun ( p = 0.0086), c-jun phosphorylation ( p = 0.0031), atrogin-1 ( p = 0.0333), MuRF-1 ( p = 0.0021), and DUSP22 ( p = 0.0026) (n = 3). ( J ) Quantification of expression and phosphorylation levels. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Phospho-proteomics, Control, Activity Assay, Expressing, Immunostaining

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Chemical structure of BML-260 and CB-Dock2 modeling of BML-260 binding to the active site of human DUSP22 (Pocket C5 and score -5.8. Chain A: GLY-1, PRO0, ASP57, CYS88, LEU89, ALA90, GLY91, VAL92, SER93, ARG94, SER123, CYS124, ALA125, ASN126, ASN128). ( B ) Fast myosin (MYH2) immunostaning of C2C12 myoblasts cultured as follows: (1) DM for 120 h (untreated); (2) DM for 96 h and DM plus 10 μM Dex for 24 h; (3) DM for 96 h and DM plus 10 μM Dex and 12.5 μM BML-260 for 24 h (scale bar = 100 μm). ( C ) Mean myotube diameter ( n = 4, p = (Vehicle = 0.0038), (BML-260 = 0.0051)). ( D ) Myotube diameter distribution. ( E ) Fusion index ( n = 3). ( F ) Differentiation index ( n = 3, p = (Vehicle = 0.0731), (BML-260 = 0.0282)). ( G ) SUnSET assay of protein synthesis rate measuring puromycin incorporation ( n = 3). ( H ) Quantification of the SUnSET assay ( p = (Vehicle = 0.0747), (BML-260 = 0.0401)). ( I ) qPCR analysis of atrogin-1 ( p = (Vehicle = 7.65E−07), (BML-260 = 0.0194)) and MuRF-1( p = (Vehicle = 7.01E−06), (BML-260 = 0.112)) expression ( n = 12). ( J ) Western blot analysis of atrogin-1, MuRF-1, and DUSP22. ( K – M ) Quantification of atrogin-1 ( p = Vehicle (3.74E−09), Dex+BML-260 (0.0016)), MuRF-1 ( p = Vehicle (0.0002), Dex+BML-260 (0.0025)) ( n = 6) and DUSP22 ( p = Vehicle (0.0029), Dex+BML-260 (0.0737)) ( n = 3). *= p < 0.05, **= p < 0.01, and ****= p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Binding Assay, Cell Culture, Expressing, Western Blot

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Schematic of the experimental protocol. ( B ) Western blot analysis of DUSP22 in the Dex-treated tibialis anterior (TA) muscle 3 d after delivery of control or DUSP22 siRNA ( n = 3). ( C ) Quantification of DUSP22 expression ( n = 3, p = 0.0308). ( D ) TA muscle mass ( n = 4, p = (siCON = 0.006, siDUSP22+Dex = 0.0042)). ( E ) Representative H&E staining, and myosin heavy chain IIa (MYHIIa; type 2 A) and IIb (MYHIIb; type 2B) immunostaining of the TA muscle. ( F ) TA myofiber CSA ( n = 4, p = ((siCON = 1.34E−30, siDUSP22+Dex = 1.31E−22)). At least 80 fibers were measured for each sample ( G ) TA myofiber area distribution. ( H ) Type 2A myofiber distribution. ( I ) Type 2B myofiber distribution. ( J ) Western blot analysis of phosphorylated FOXO3a (p-FOXO3a), FOXO3a, phosphorylated c-jun (p-c-jun), c-jun, phosphorylated JNK (p-JNK), JNK in the TA muscle ( n = 4). ( K ) Quantification of p-FOXO3a ( p = ((siCON = 0.0958, siDUSP22+Dex = 0.0255)), FOXO3a ( p = ((siCON = 0.0068, siDUSP22+Dex = 0.0.001)), P-JNK ( p = ((siCON = 0.1087, siDUSP22+Dex = 0.1271)), and JNK ( p = ((siCON = 1.61E−05, siDUSP22+Dex = 0.0004)). ( L ) Quantification of P-c-jun ( p = ((siCON = 0.5016, siDUSP22+Dex = 0.0017)) and c-jun ( p = ((siCON = 6.27E−06, siDUSP22+Dex = 3.52E−06)). GAPDH was used for the normalization of FOXO3a, p-JNK, JNK, p-c-Jun and c-Jun expression. FOXO3a was used for the normalization of p-FOXO3a expression. ( M ) Western blot analysis of p62 ( p = ((siCON = 0.0297, siDUSP22+Dex = 0.0042)) and MuRF-1 ( p = ((siCON = 0.1484, siDUSP22+Dex = 0.0245)) ( n = 4). GAPDH was used for normalization of expression. ( N ) Quantification of p62 and MuRF-1. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Control, Expressing, Staining, Immunostaining

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A , B ) Western blot and densitometry analysis of AKT phosphorylation in the Dex-treated tibialis anterior (TA) muscle 3 d after delivery of control or DUSP22 siRNA ( n = 4) ( p = (siCON = 0.029, siDUSP22+Dex = 0.0412)). GAPDH was used for normalization of expression. * p < 0.05 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Phospho-proteomics, Control, Expressing

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Tetanic muscle contraction measurement in the TA muscle of aged ( n = 3) ( p = 0.3974) or middle aged mice ( n = 4) ( p = 0.0807) 3 d after the delivery of control or DUSP22 siRNA. ( B ) Twitch force measure in 15-month-old mice 3 d after the delivery of control or DUSP22 siRNA ( n = 4) ( p = 0.1054, 0.1677, 0.1964, 0.1858, 0.2118, 0.234, 0.2489, 0.2684, 0.2947). n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Control

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Schematic of the experimental protocol. ( B ) Body weight during 13 d treatment with vehicle, 15 mg/kg Dex, or 15 mg/kg Dex and 5 mg/kg BML-260. ( C ) Grip strength ( n = 4, p = (Vehicle = 0.3426, BML-260 = 0.224). ( D ) Rotarod performance in the constant (RPM) ( p = (Vehicle = 0.05, BML-260 = 0.0263)) and acceleration (latency to fall) ( p = (Vehicle = 0.0003, BML-260 = 0.0132)) models ( n = 4). ( E ) Representative H&E staining of the gastrocnemius muscle. ( F ) Myofiber CSA ( n = 4, p = (Vehicle = 1.98E−84, BML-260 = 2.93E−32)). ( G ) Myofiber area distribution. At least 100 fibers were measured for each sample ( H ) TA muscle mass ( n = 4, p = (Vehicle = 0.0042, BML-260 = 0.0208)). ( I , J ) Western blot analysis of atrogin-1 ( p = (Vehicle = 0.0029, BML-260 = 0.0014)), MuRF-1 ( p = (Vehicle = 0.0086, BML-260 = 0.0498)), and DUSP22 ( p = (Vehicle = 0.0034, BML-260 = 0.0258)) expression in the TA muscle ( n = 3). GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Staining, Western Blot, Expressing

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Experimental protocol to knockdown DUSP22 expression in the TA of aged mice. ( B ) Western blot analysis of DUSP22 and MuRF-1 and expression levels ( n = 4). GAPDH was used for normalization of expression. ( C ) Quantification of DUSP22 ( p = (3 M = 0.0004, 27 M+siDUSP22 = 0.0007)) and MuRF-1 ( p = (3 M = 0.0148, 27 M+siDUSP22 = 0.0046)). ( D ) Change in TA muscle mass ( p = 0.1749) over the course of the experiment. ( E ) Representative H&E staining of the TA muscle. ( F ) TA myofiber CSA ( n = 5, p = 7.54E−35). At least 150 fibers were measured for each sample ( G ) Western blot of FOXO3a, atrogin-1, MuRF-1, and DUSP22 levels in the TA muscle from the control siRNA treated left and DUSP22 siRNA treated right leg ( n = 4). ( H ) Change in FOXO3a ( p = 0.1852), atrogin-1 ( p = 0.0532), and MuRF-1 ( p = 0.0052), DUSP22 ( p = 0.1466) expression relative to GAPDH. ( I ) Experimental protocol for DUSP22 pharmacological targeting in aged mice. ( J ) Body weight over the course of the experiment. ( K ) Grip strength ( p = (5 M = 0.0002, Aged+BML-260 = 0.0702) and rotarod performance ( p = 0.0381) in the latency to fall test ( n = 5,4). ( L ) Mass of the quadriceps ( p = (5 M = 0.0002, Aged+BML-260 = 0.0539), gastrocnemius ( p = (5 M = 0.0003, Aged+BML-260 = 0.0383), TA ( p = (5 M = 0.0229, Aged+BML-260 = 0.04919) and soleus ( p = (5 M = 0.1484, Aged+BML-260 = 0.2699) muscles ( n = 5). ( M ) qPCR analysis of MuRF-1( p = 0.0194) and atrogin-1 ( p = 0.0737) expression ( n = 3,4). ( N ) qPCR analysis of myostatin (Mstn) ( p = 0.0072) and PGC-1α ( p = 0.0423) expression ( n = 3,4). ( O ) MYHIIa (type 2a), MYHIIb (type 2b), and MYHIIx (type 2x), DAPI and laminin staining in the TA and gastrocnemius muscles (5 M = 5 months-old). Scale bar = 100 µm. ( P ) CSA of the type 2a ( p = (5 M = 0.0016, Aged+BML-260 = 0.1403), 2b ( p = (5 M = < 0.0001, Aged+BML-260 = 0.0004), and 2x ( p = (5 M = 0.001, Aged+BML-260 = 0.005) myofibers ( n = 4). ( Q ) Minimal Feret’s diameter of the type 2a ( p = (5 M = 0.0057, Aged+BML-260 = 0.0662), 2b ( p = (5 M = < 0.0001, Aged+BML-260 = 0.0017), and 2x ( p = (5 M = 0.0092, Aged+BML-260 = 0.0155) myofibers. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Knockdown, Expressing, Western Blot, Staining, Control, Muscles

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Western blot analysis of DUSP22 expression in the TA of aged mice treated with BML-260 ( n = 4,3) ( p = (Young = 0.0362, Aged+BML-260 = 0.0054)). GAPDH was used for normalization of expression. * p < 0.05 and ** p < 0.01 indicate significantly increased or decreased. ( B , C ) Western blot analysis of DUSP22 expression in the TA ( n = 3,5,6) ( p = (Sham = 0.0051, BML-260 = 0.0488)) ( B ) and gastrocnemius muscle ( n = 3,5,6) ( p = (Sham=0.6845, BML-260 = 0.0008)) ( C ) of immobilized (IMM) mice treated with BML-260. For the TA muscle, MYH4 (myosin heavy chain 2B) ( p = (Sham=0.0253, BML-260 = 0.0288)) levels are also shown. GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Expressing

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Effect of immobilization on skeletal muscle mass using the plastic EP tube method ( n = 3). ( B ) qPCR analysis of DUSP22 expression in the TA muscle (IM = immobilized) ( n = 3) ( p = 0.018). ( C ) Plot of DUSP22 expression in relation to TA mass ( n = 6). ( D ) Western blot analysis of DUSP22 expression ( n = 3) ( p = 0.1699). ( E ) TA mass ( n = 9,7) ( p = (Sham = <0.0001, BML-260 = 0.007)). ( F ) Western blot analysis of atrogin-1( p = (Sham = 0.0005, BML-260 = 0.0009)), MuRF-1 ( p = (Sham = 0.008, BML-260 = 0.0057)), and DUSP22 ( p = (Sham = 0.0007, BML-260 = 0.054)) levels in the TA muscle ( n = 3). Quantification of atrogin-1, MuRF-1, and DUSP22 levels relative to GAPDH are also shown. ( G ) Micrographs of MYH2-immunostained human myotubes treated as follows: 1) Vehicle alone, 2) 10 μM Dex for 24 h, 3) 10 μM Dex and 12.5 μM BML-260 for 24 h. ( H ) Mean myotube diameter ( n = 5,4) ( p = (Vehicle = 0.0001, BML-260 = 0.033)). ( I ) Micrographs of MYH2-immunostained human myotubes treated as follows: (1) 48 h incubation in with DM plus control, scrambled siRNA; (2) 48 h incubation with DM plus DUSP22 siRNA: (3) 24 h incubation with DM plus control, scrambled siRNA and additional 24 h treatment with 10 μM Dex plus siRNA; (4) 24 h incubation with DM plus DUSP22 siRNA and additional 24 h treatment with 10 μM Dex plus siRNA. ( J ) Myotube diameter ( n = 7,5) ( p = (siCON = 9.79E−06., siDUSP22+Dex = 0.0003)). ( K ) qPCR analysis of DUSP22 expression in the Dex-treated human myotubes ( n = 3) ( p = 0.0129). ( L ) qPCR analysis of MuRF-1( p = (siCON = 0.0286, siDUSP22+Dex = 0.049)) expression in the Dex-treated human myotubes ( n = 3). * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. ( M ) Working model of the effect of DUSP22 targeting on skeletal muscle atrophy: 1) In healthy muscle, Akt signaling can promote hypertrophy by increasing protein synthesis and inhibiting the activity of FOXO3a. 2) In the context of skeletal muscle wasting, the Akt pathway can become suppressed and FOXO3a signaling is upregulated. The results from this study show that targeting DUSP22 in wasting muscle downregulates JNK and reduces FOXO3a signaling. These events occur independently of Akt signaling activation, which remains suppressed. DUSP22 targeting, via pharmacology or gene knockdown, is sufficient to enhance function, improve histopathology, and lower atrogene expression in multiple forms of skeletal muscle wasting. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Expressing, Western Blot, Incubation, Control, Activity Assay, Activation Assay, Knockdown, Histopathology

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: Western blot analysis of DUSP22 ( p = (Sham = 0.0341, BML-260 = 0.0494)), JNK and phosphorylated JNK (JNK-P) ( p = (Sham = 0.0052, BML-260 = 0.0007)) levels in the TA muscle of immobilized mice ( n = 3,4). GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Expressing

Journal: bioRxiv

Article Title: Cellular- and systems-level profiling of amyloid-beta effects on circadian timing

doi: 10.64898/2025.12.22.695794

Figure Lengend Snippet: Coronal brain sections from 8 month-old WT and 5xFAD mice were immunolabeled for Aβ (white fluorescence) and two peptide markers of the SCN-arginine vasopressin (AVP-red fluorescence: Panel A) and vasoactive intestinal peptide (VIP-red fluorescence: Panel B)-and cellular nuclei were labeled with Hoechst (blue fluorescence). In A , high magnification images of the SCN are shown below each whole-brain coronal section. Representative images from 5xFAD tissue reveal marked Aβ-based plaque formation in a number of forebrain structures, including the cortex (CTX); However, plaque deposition was not observed in the SCN. Of note, AVP and VIP expression were indistinguishable between WT and 5xFAD mice, suggesting that the SCN was intact in 5xFAD animals. Bar for the low magnification image: 1000 microns; Bar for the high magnification image in A: 300 microns. C) Dot-blot protein profiling of 5xFAD and WT tissue indicates the presence of Aβ species in both the cortex and SCN of 5xFAD mice. As a control, lysates were also probed for β-actin. Further, the sensitivity of the Aβ antibody was confirmed by probing for recombinant Aβ.

Article Snippet: Membranes were subsequently incubated for 90 minutes at 4°C with either mouse anti-Aβ antibody (1:1,500; Novus Biologicals, NBP2-1307) or anti-mouse β-actin antibody (1:100,000; Phosphosolutions, 125-ACT); Membranes was washed and then exposed to an HRP-conjugated goat anti-mouse IgG secondary antibody (1:2,000; Fisher Scientific, NEF822001EA) for 2 hours at room temperature.

Techniques: Immunolabeling, Fluorescence, Labeling, Expressing, Dot Blot, Control, Recombinant