abca1 Search Results


94
Novus Biologicals mouse anti mouse abca1 antibody
MCP-1 inhibited the mRNA, total, and cell-surface protein expression of <t>ABCA1,</t> ABCG1, and SR-B1 in differentiated 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were treated with either increasing concentrations of MCP-1 (0–80 ng/ml) for 48 h or with MCP-1 at 40 ng/ml for increasing times (0, 24, 48, 72 h). (a) Dose response of MCP-1 on ABCA1, ABCG1, and SR-B1 mRNA expression. (b) Time course of MCP-1 on ABCA1, ABCG1, and SR-B1 mRNA expression. Total proteins and cell surface proteins were extracted from the cultured cells, and the protein expressions of ABCA1, ABCG1, and SR-B1 were detected as described in “Materials and Methods.” The quantitative analysis of proteins was performed using Image-J software. (c) Dose response of MCP-1 on the total protein expression of ABCA1, ABCG1, and SR-B1. (d) Time course of MCP-1 on the total protein expression of ABCA1, ABCG1, and SR-B1. (e) Dose response and time course of MCP-1 on the cell surface protein expression of ABCA1, ABCG1, and SR-B1. (f) The effect of MCP-1 on the expression of ABCA1, ABCG1, and SR-B1 by confocal microscopy. Differentiated 3T3-L1 adipocytes grown on glass cover slips were serum-starved for 6 h, followed by incubation in serum-free medium in the absence or presence of MCP-1 (40 ng/ml) for 48 h. ABCA1, ABCG1, and SR-BI were labeled with Alexa 546 (red), Alexa 488 (green), and Alexa 633 (pink), respectively. The protein expression of ABCA1, ABCG1, and SR-BI was analyzed using confocal microscopy (LSM780) (×63), as described in “Materials and Methods.” ( (a–f) , n = 3). *P < 0.05 compared with untreated cells
Mouse Anti Mouse Abca1 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti mouse abca1 antibody/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
mouse anti mouse abca1 antibody - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

92
R&D Systems human abca1 np 005493 versaclone cdna plasmid
<t>ABCA1</t> expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.
Human Abca1 Np 005493 Versaclone Cdna Plasmid, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human abca1 np 005493 versaclone cdna plasmid/product/R&D Systems
Average 92 stars, based on 1 article reviews
human abca1 np 005493 versaclone cdna plasmid - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

95
Novus Biologicals abca1
( A ) Expression of Rnf145 was evaluated in the indicated mouse tissues by qPCR. Bars indicate mean ± SD (n = 3) ( B , C ) The indicated ( B ) human and ( C ) mouse cell lines and primary macrophages were cultured in lipoprotein-depletion medium for 16 hours and subsequently treated for 6 hours with 1μM GW3965 (GW). ( D ) THP1 cells were cultured in sterol depletion medium for 16 hrs and then treated with 1μM GW3965 (GW) and 100nM LG100268 (LG) for 6 hrs as indicated. Subsequently, <t>ABCA1</t> and RNF145 expression was determined by qPCR and each bar and error represents the mean fold-change of ligand-treated cells over sterol-depleted cells ± SD (n≥3).
Abca1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/abca1/product/Novus Biologicals
Average 95 stars, based on 1 article reviews
abca1 - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

94
Novus Biologicals rat anti abca1 antiserum
( A ) Expression of Rnf145 was evaluated in the indicated mouse tissues by qPCR. Bars indicate mean ± SD (n = 3) ( B , C ) The indicated ( B ) human and ( C ) mouse cell lines and primary macrophages were cultured in lipoprotein-depletion medium for 16 hours and subsequently treated for 6 hours with 1μM GW3965 (GW). ( D ) THP1 cells were cultured in sterol depletion medium for 16 hrs and then treated with 1μM GW3965 (GW) and 100nM LG100268 (LG) for 6 hrs as indicated. Subsequently, <t>ABCA1</t> and RNF145 expression was determined by qPCR and each bar and error represents the mean fold-change of ligand-treated cells over sterol-depleted cells ± SD (n≥3).
Rat Anti Abca1 Antiserum, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat anti abca1 antiserum/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
rat anti abca1 antiserum - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

86
Biosynth Carbosynth rabbit anti abca1 antibody
Fig. 2. Caveolin partitioning to lipid raft/caveolae membrane domains in mouse primary macrophages. Lipid raft/caveolae membranes were isolated as described by Machleidt et al. (20). Cells were solubilized in 1% Triton X-100 and lipid raft/caveolae membrane fraction separated by centrifugation in a (10–30%) linear sucrose gradient. After centrifugation for 21 h in SW41 rotor fractions (1–14) were collected from the top and together with pelleted material (Pt) analyzed by SDS-PAGE and immunoblotting. Total protein loading after transfer to PVDF membrane was visualized by Ponceau S staining (A). Portion from each fraction was analyzed for alkaline phosphatase (AP) activity (lipid raft/caveolae marker) using an alkaline phosphatase substrate kit (Bio-Rad) (B). Caveolin-1, caveolin-2, -actin, and <t>ABCA1</t> expression was analyzed by immuno- blotting (C). Rabbit anti-ABCA1 antibody was a gift from Michael L. Fitzgerald and Mason W. Freeman (Mas- sachusetts General Hospital and Harvard Medical School).
Rabbit Anti Abca1 Antibody, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti abca1 antibody/product/Biosynth Carbosynth
Average 86 stars, based on 1 article reviews
rabbit anti abca1 antibody - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc monoclonal anti abca1 antibody
Treg exp increase <t>ABCA1</t> expression by transferring cAMP into M IL4 . (A) Changes in the expression of ABCA1 and ABCG1 transcripts in M IL4 co-cultured with either Teffs or Treg exp . Gene expression quantified by qRT-PCR comparing mRNA levels in M IL4 alone (RQ = 1, shown as dashed line) with the same cells co-cultured for 4h with either Teffs or Tregs. UBC was used as reference gene. (B) Intracellular concentration of cAMP in Tregs exp alone, M IL4 alone, or M IL4 co-cultured with Tregs exp for 4h. cAMP levels were normalized to total cellular protein content. Statistical analysis was performed only between M IL4 and M IL4 + Tregs exp , as the aim was to assess whether cAMP levels in M IL4 increase upon co-culture. The cAMP level in Tregs exp is shown as a reference to highlight the high concentration of this molecule in these cells but was not included in the statistical comparison due to the difference in cell type. (C) Changes in the expression of ABCA1 mRNA in M IL4 co-cultured with Treg exp (ratio 1:1) after 1h preincubation or not with GAP27 (300 µM). (D) Changes in the expression of ABCA1 mRNA in M IL4 co-cultured with Tregs (ratio 1:1) after 1h preincubation or not with PKA inhibitor H89 (5 µM). (E) Western blot analysis of <t>ABCA1</t> <t>protein</t> level in cell lysates of M IL4 alone or M IL4 co-cultured (ratio 1:1) with either Treg exp or Teff for 4h. Data were plotted as ABCA1 protein intensity normalised to GAPDH protein intensity. Statistical analysis was performed using one-way ANOVA followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01.
Monoclonal Anti Abca1 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal anti abca1 antibody/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
monoclonal anti abca1 antibody - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

94
Novus Biologicals polyclonal anti abca1 antibody
FIG. 3. <t>ABCA1</t> overexpression inhibits A secretion. A, <t>ABCA1</t> <t>protein</t> in Neuro2a cells after LXR activation (top panel) or transient transfection (bottom panel), showing similar expression levels relative to actin. B and C, A peptide in medium was determined by immunopre- cipitation and immunoblotting; cellular APP (cAPP) was determined by immunoblotting cell lysates. The bar graphs show combined data from three or more independent experiments. *, p 0.01 compared with mock (mk) control. B, Neuro2a-APPSw cells were transfected with either mock control plasmid or ABCA1 cDNA. ApoA-I (A1) was added for 6 h where indicated. C, Neuro2a-APPsw cells were transfected with empty vector (control) or vector containing ABCA1 cDNA or ABCA1 with a mutation in the ATP-binding cassette (Walker motif mutation). Filled bar, no apolipoprotein added; hatched bar, apoA-I added.
Polyclonal Anti Abca1 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal anti abca1 antibody/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
polyclonal anti abca1 antibody - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

94
Novus Biologicals rabbit antimouse abca1
Figure 9. MCPIP1 deficiency increased macrophage cholesterol efflux. A. Bone marrow-derived macrophages were loaded with ac-LDL and cholesterol efflux to DMEM, apoAI and HDL was measured. Data were presented as mean 6 SEM. N = 3 in each group. B. Bone marrow-derived macrophages were cultured in DMEM for 48 h with or without ac-LDL. Cell lysates were used for western blotting analysis for <t>ABCA1</t> and ABCG1. Representative western blotting result was shown. C. Quantitative analysis of the western blots. Data were presented as mean 6 SEM. N = 4 in each group. Open column: WT macrophages; Black column, MCPIP12/2 macrophages. doi:10.1371/journal.pone.0080089.g009
Rabbit Antimouse Abca1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit antimouse abca1/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
rabbit antimouse abca1 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
Neuromics monoclonal mouse anti abca1
Figure 9. MCPIP1 deficiency increased macrophage cholesterol efflux. A. Bone marrow-derived macrophages were loaded with ac-LDL and cholesterol efflux to DMEM, apoAI and HDL was measured. Data were presented as mean 6 SEM. N = 3 in each group. B. Bone marrow-derived macrophages were cultured in DMEM for 48 h with or without ac-LDL. Cell lysates were used for western blotting analysis for <t>ABCA1</t> and ABCG1. Representative western blotting result was shown. C. Quantitative analysis of the western blots. Data were presented as mean 6 SEM. N = 4 in each group. Open column: WT macrophages; Black column, MCPIP12/2 macrophages. doi:10.1371/journal.pone.0080089.g009
Monoclonal Mouse Anti Abca1, supplied by Neuromics, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal mouse anti abca1/product/Neuromics
Average 93 stars, based on 1 article reviews
monoclonal mouse anti abca1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Novus Biologicals antibodies against abca1
FIGURE 1. Gene silencing of OSBP increases <t>ABCA1</t> expression. A, CHO cells stably expressing an shOSBP or a nontargeting control (shNT) were treated with solvent (no addition (NA)), 10 nM RA alone, or 22OH or 25OH (0.125–1.0 g/ml) plus 10 nM RA for 18 h. Cell lysates were resolved by 6–10% SDS-PAGE and analyzed by immunoblotting using primary antibodies against OSBP, ABCA1, and tubulin (Tub). B, shNT and shOSBP cells were treated with solvent (NA) or 22OH (1.0 g/ml) with and without RA for 0–12 h. Cells lysates were analyzed by immunoblotting with primary antibodies against ABCA1 and actin. The extent of OSBP knockdown in shOSBP cells was similar to results in A. C, CHO cells were transfected with siOSBP (25 nM) or siNT for 48 h. Cells were treated with 22OH or 25OH (1.0 g/ml) with or without RA (10 nM) for 18 h. Whole cell lysates were resolved by SDS-PAGE and immunoblotted using antibodies against ABCA1 and OSBP. D, J774 macrophages were transfected with siNT or siOSBP for 48 h and treated with 22OH (1 g/ml) or TO091317 (TO) (1 M) with RA (10 nM) for 18 h prior to immunoblotting for ABCA1, OSBP, and actin.
Antibodies Against Abca1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies against abca1/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
antibodies against abca1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


MCP-1 inhibited the mRNA, total, and cell-surface protein expression of ABCA1, ABCG1, and SR-B1 in differentiated 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were treated with either increasing concentrations of MCP-1 (0–80 ng/ml) for 48 h or with MCP-1 at 40 ng/ml for increasing times (0, 24, 48, 72 h). (a) Dose response of MCP-1 on ABCA1, ABCG1, and SR-B1 mRNA expression. (b) Time course of MCP-1 on ABCA1, ABCG1, and SR-B1 mRNA expression. Total proteins and cell surface proteins were extracted from the cultured cells, and the protein expressions of ABCA1, ABCG1, and SR-B1 were detected as described in “Materials and Methods.” The quantitative analysis of proteins was performed using Image-J software. (c) Dose response of MCP-1 on the total protein expression of ABCA1, ABCG1, and SR-B1. (d) Time course of MCP-1 on the total protein expression of ABCA1, ABCG1, and SR-B1. (e) Dose response and time course of MCP-1 on the cell surface protein expression of ABCA1, ABCG1, and SR-B1. (f) The effect of MCP-1 on the expression of ABCA1, ABCG1, and SR-B1 by confocal microscopy. Differentiated 3T3-L1 adipocytes grown on glass cover slips were serum-starved for 6 h, followed by incubation in serum-free medium in the absence or presence of MCP-1 (40 ng/ml) for 48 h. ABCA1, ABCG1, and SR-BI were labeled with Alexa 546 (red), Alexa 488 (green), and Alexa 633 (pink), respectively. The protein expression of ABCA1, ABCG1, and SR-BI was analyzed using confocal microscopy (LSM780) (×63), as described in “Materials and Methods.” ( (a–f) , n = 3). *P < 0.05 compared with untreated cells

Journal: Cardiovascular Drugs and Therapy

Article Title: Insulin Rescued MCP-1-Suppressed Cholesterol Efflux to Large HDL2 Particles via ABCA1, ABCG1, SR-BI and PI3K/Akt Activation in Adipocytes

doi: 10.1007/s10557-021-07166-2

Figure Lengend Snippet: MCP-1 inhibited the mRNA, total, and cell-surface protein expression of ABCA1, ABCG1, and SR-B1 in differentiated 3T3-L1 adipocytes. Differentiated 3T3-L1 adipocytes were treated with either increasing concentrations of MCP-1 (0–80 ng/ml) for 48 h or with MCP-1 at 40 ng/ml for increasing times (0, 24, 48, 72 h). (a) Dose response of MCP-1 on ABCA1, ABCG1, and SR-B1 mRNA expression. (b) Time course of MCP-1 on ABCA1, ABCG1, and SR-B1 mRNA expression. Total proteins and cell surface proteins were extracted from the cultured cells, and the protein expressions of ABCA1, ABCG1, and SR-B1 were detected as described in “Materials and Methods.” The quantitative analysis of proteins was performed using Image-J software. (c) Dose response of MCP-1 on the total protein expression of ABCA1, ABCG1, and SR-B1. (d) Time course of MCP-1 on the total protein expression of ABCA1, ABCG1, and SR-B1. (e) Dose response and time course of MCP-1 on the cell surface protein expression of ABCA1, ABCG1, and SR-B1. (f) The effect of MCP-1 on the expression of ABCA1, ABCG1, and SR-B1 by confocal microscopy. Differentiated 3T3-L1 adipocytes grown on glass cover slips were serum-starved for 6 h, followed by incubation in serum-free medium in the absence or presence of MCP-1 (40 ng/ml) for 48 h. ABCA1, ABCG1, and SR-BI were labeled with Alexa 546 (red), Alexa 488 (green), and Alexa 633 (pink), respectively. The protein expression of ABCA1, ABCG1, and SR-BI was analyzed using confocal microscopy (LSM780) (×63), as described in “Materials and Methods.” ( (a–f) , n = 3). *P < 0.05 compared with untreated cells

Article Snippet: The adipocytes were incubated at 4 °C overnight with a 1:25 dilution of mouse anti-mouse ABCA1 antibody, a 1:200 dilution of rabbit anti-mouse ABCG1 antibody and a 1:50 dilution of goat anti-mouse SR-BI antibody (Novus Biologicals, CO, USA) in blocking buffer.

Techniques: Expressing, Cell Culture, Software, Confocal Microscopy, Incubation, Labeling

Insulin rescues MCP-1-mediated mRNA, total and surface protein suppression of ABCA1, ABCG1, and SR-B1 via PI3K/Akt activation in differentiated 3T3-L1 adipocytes. Cells were serum-starved for 6 h, followed by pretreatment with (+) or without (−) the PI3K inhibitor wortmannin for 45 min. The cells were then incubated with (+) or without (−) insulin (100 nM) and MCP-1 (40 ng/ml). (a–c) Insulin rescues MCP-1 mediated mRNA suppression of ABCA1, ABCG1and SR-B1. (d, e) Insulin rescues the total protein expression of the three receptors. (f) Insulin rescues the surface protein expression of the three receptors. Cell surface receptor levels and Na + /K + ATPases were directly extracted using cell surface biotinylation and then measured using western blotting, as described in “Materials and Methods.” (g) Insulin rescues the expression of the three receptors by confocal microscopy (×63). ABCA1, SR-BI, and ABCG1 labeled with Alexa 546 (red), Alexa 633 (pink), and Alexa 488 (green), respectively, were detected by confocal microscopy as describe in “Materials and Methods.” Note that insulin reversed the MCP-1-mediated decreases in ABCA1, ABCG1, and SR-BI mRNA and protein levels, and this correction was inhibited by wortmannin. ( (a–g) : n = 3). * P < 0.05 compared with untreated cells; # P < 0.05 compared with MCP-1- or insulin-treated cells; + P < 0.05 compared with MCP-1 or insulin-treated cells

Journal: Cardiovascular Drugs and Therapy

Article Title: Insulin Rescued MCP-1-Suppressed Cholesterol Efflux to Large HDL2 Particles via ABCA1, ABCG1, SR-BI and PI3K/Akt Activation in Adipocytes

doi: 10.1007/s10557-021-07166-2

Figure Lengend Snippet: Insulin rescues MCP-1-mediated mRNA, total and surface protein suppression of ABCA1, ABCG1, and SR-B1 via PI3K/Akt activation in differentiated 3T3-L1 adipocytes. Cells were serum-starved for 6 h, followed by pretreatment with (+) or without (−) the PI3K inhibitor wortmannin for 45 min. The cells were then incubated with (+) or without (−) insulin (100 nM) and MCP-1 (40 ng/ml). (a–c) Insulin rescues MCP-1 mediated mRNA suppression of ABCA1, ABCG1and SR-B1. (d, e) Insulin rescues the total protein expression of the three receptors. (f) Insulin rescues the surface protein expression of the three receptors. Cell surface receptor levels and Na + /K + ATPases were directly extracted using cell surface biotinylation and then measured using western blotting, as described in “Materials and Methods.” (g) Insulin rescues the expression of the three receptors by confocal microscopy (×63). ABCA1, SR-BI, and ABCG1 labeled with Alexa 546 (red), Alexa 633 (pink), and Alexa 488 (green), respectively, were detected by confocal microscopy as describe in “Materials and Methods.” Note that insulin reversed the MCP-1-mediated decreases in ABCA1, ABCG1, and SR-BI mRNA and protein levels, and this correction was inhibited by wortmannin. ( (a–g) : n = 3). * P < 0.05 compared with untreated cells; # P < 0.05 compared with MCP-1- or insulin-treated cells; + P < 0.05 compared with MCP-1 or insulin-treated cells

Article Snippet: The adipocytes were incubated at 4 °C overnight with a 1:25 dilution of mouse anti-mouse ABCA1 antibody, a 1:200 dilution of rabbit anti-mouse ABCG1 antibody and a 1:50 dilution of goat anti-mouse SR-BI antibody (Novus Biologicals, CO, USA) in blocking buffer.

Techniques: Activation Assay, Incubation, Expressing, Cell Surface Receptor Assay, Western Blot, Confocal Microscopy, Labeling

Proposed model of the effect of Insulin on MCP-1-mediated suppression of cholesterol efflux to large HDL2 particles and regulatory mechanism in 3T3-L1 adipocytes. Increased MCP-1 level has a significant, negative correlation with HDL2-C in CAD patients with obesity and overweight. MCP-1 decreases the expression of ABCA1, ABCG1, and SR-B1, leading to the reduction of cholesterol efflux. Insulin rescues the expression of the three receptors via PI3K/Akt activation and restores the cholesterol efflux to HDL2. (+), Activation; (−), Inhibition

Journal: Cardiovascular Drugs and Therapy

Article Title: Insulin Rescued MCP-1-Suppressed Cholesterol Efflux to Large HDL2 Particles via ABCA1, ABCG1, SR-BI and PI3K/Akt Activation in Adipocytes

doi: 10.1007/s10557-021-07166-2

Figure Lengend Snippet: Proposed model of the effect of Insulin on MCP-1-mediated suppression of cholesterol efflux to large HDL2 particles and regulatory mechanism in 3T3-L1 adipocytes. Increased MCP-1 level has a significant, negative correlation with HDL2-C in CAD patients with obesity and overweight. MCP-1 decreases the expression of ABCA1, ABCG1, and SR-B1, leading to the reduction of cholesterol efflux. Insulin rescues the expression of the three receptors via PI3K/Akt activation and restores the cholesterol efflux to HDL2. (+), Activation; (−), Inhibition

Article Snippet: The adipocytes were incubated at 4 °C overnight with a 1:25 dilution of mouse anti-mouse ABCA1 antibody, a 1:200 dilution of rabbit anti-mouse ABCG1 antibody and a 1:50 dilution of goat anti-mouse SR-BI antibody (Novus Biologicals, CO, USA) in blocking buffer.

Techniques: Expressing, Activation Assay, Inhibition

ABCA1 expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: ABCA1 expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Migration, Gene Expression, Standard Deviation, Western Blot, Over Expression, Transwell Migration Assay, Membrane

ABCA1 expression is differentially regulated in mesenchymal cell lines through the E-box motif in its proximal promoter. ( a ) This schematic outlines the structure of ABCA1 alternative promoters. ( b ) Luminescence induced by alternative proximal promoters P1 or P2 are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) Luminescence induced by promoter P1, or promoter fragments P1a and P1b, are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. ( d ) This shows the mutations introduced to the P1b promoter fragment to disrupt binding capacity of the E-box, SP1, and LXR motifs. Mutations are labeled in bold. ( e ) Luminescence is shown on the x -axis for each of the mutant promoters in the MCF7, HMLE, MDA-MB-231, and HMLE-Twist cell lines ( n = 4 technical replicates, for each). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: ABCA1 expression is differentially regulated in mesenchymal cell lines through the E-box motif in its proximal promoter. ( a ) This schematic outlines the structure of ABCA1 alternative promoters. ( b ) Luminescence induced by alternative proximal promoters P1 or P2 are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) Luminescence induced by promoter P1, or promoter fragments P1a and P1b, are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. ( d ) This shows the mutations introduced to the P1b promoter fragment to disrupt binding capacity of the E-box, SP1, and LXR motifs. Mutations are labeled in bold. ( e ) Luminescence is shown on the x -axis for each of the mutant promoters in the MCF7, HMLE, MDA-MB-231, and HMLE-Twist cell lines ( n = 4 technical replicates, for each). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Standard Deviation, Binding Assay, Labeling, Mutagenesis

MYC binds to the ABCA1 promoter and represses its expression in epithelial cells. ( a ) This volcano plot shows the relative log 2 expression of E-box binding transcription factors on the x -axis. Each transcription factor is shown as a dot, and those expressed higher in mesenchymal cells are shown on the right, while those expressed higher in epithelial cells are on the left. The y -axis shows the −log 10 of the p -value. A dotted line indicates p = 0.05. ( b ) The gene ( top ) and protein ( bottom ) expressions of ABCA1 are shown for four cell lines ( n = 3 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) The relative gene expressions of ABCA1 , MYC , or CDH1 are shown on the y -axis across time ( x -axis) in log scale ( n = 3 technical replicates). Error bars indicate one standard deviation. ( d ) ( top panel ) The relative gene expressions of ABCA1 or MYC in HMLE cells are shown on the y -axis after knockdown with three independent siRNAs targeting MYC ( n = 3 technical replicates). Error bars indicate one standard deviation. ( bottom ) These immunoblots show the protein expression in the same conditions. ( e ) The binding affinity of MYC to the ABCA1 promoter or a gene desert ( GD ) region is quantified relative to input ( y -axis) ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for experiments shown in panels b, d, and e, and representative data are shown. The data in panel ( a ) were aggregated from six data sets. For panel ( c ), the time series has been measured over five times, but the time points profiled in the middle samples varied. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: MYC binds to the ABCA1 promoter and represses its expression in epithelial cells. ( a ) This volcano plot shows the relative log 2 expression of E-box binding transcription factors on the x -axis. Each transcription factor is shown as a dot, and those expressed higher in mesenchymal cells are shown on the right, while those expressed higher in epithelial cells are on the left. The y -axis shows the −log 10 of the p -value. A dotted line indicates p = 0.05. ( b ) The gene ( top ) and protein ( bottom ) expressions of ABCA1 are shown for four cell lines ( n = 3 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) The relative gene expressions of ABCA1 , MYC , or CDH1 are shown on the y -axis across time ( x -axis) in log scale ( n = 3 technical replicates). Error bars indicate one standard deviation. ( d ) ( top panel ) The relative gene expressions of ABCA1 or MYC in HMLE cells are shown on the y -axis after knockdown with three independent siRNAs targeting MYC ( n = 3 technical replicates). Error bars indicate one standard deviation. ( bottom ) These immunoblots show the protein expression in the same conditions. ( e ) The binding affinity of MYC to the ABCA1 promoter or a gene desert ( GD ) region is quantified relative to input ( y -axis) ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for experiments shown in panels b, d, and e, and representative data are shown. The data in panel ( a ) were aggregated from six data sets. For panel ( c ), the time series has been measured over five times, but the time points profiled in the middle samples varied. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Binding Assay, Standard Deviation, Knockdown, Western Blot

( A ) Expression of Rnf145 was evaluated in the indicated mouse tissues by qPCR. Bars indicate mean ± SD (n = 3) ( B , C ) The indicated ( B ) human and ( C ) mouse cell lines and primary macrophages were cultured in lipoprotein-depletion medium for 16 hours and subsequently treated for 6 hours with 1μM GW3965 (GW). ( D ) THP1 cells were cultured in sterol depletion medium for 16 hrs and then treated with 1μM GW3965 (GW) and 100nM LG100268 (LG) for 6 hrs as indicated. Subsequently, ABCA1 and RNF145 expression was determined by qPCR and each bar and error represents the mean fold-change of ligand-treated cells over sterol-depleted cells ± SD (n≥3).

Journal: PLoS ONE

Article Title: Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene

doi: 10.1371/journal.pone.0172721

Figure Lengend Snippet: ( A ) Expression of Rnf145 was evaluated in the indicated mouse tissues by qPCR. Bars indicate mean ± SD (n = 3) ( B , C ) The indicated ( B ) human and ( C ) mouse cell lines and primary macrophages were cultured in lipoprotein-depletion medium for 16 hours and subsequently treated for 6 hours with 1μM GW3965 (GW). ( D ) THP1 cells were cultured in sterol depletion medium for 16 hrs and then treated with 1μM GW3965 (GW) and 100nM LG100268 (LG) for 6 hrs as indicated. Subsequently, ABCA1 and RNF145 expression was determined by qPCR and each bar and error represents the mean fold-change of ligand-treated cells over sterol-depleted cells ± SD (n≥3).

Article Snippet: Membranes were probed with the following antibodies: LDLR (Abcam, clone EP1553Y, 1:4000), tubulin (Sigma, clone DM1A, ascites fluid, 1:5000), ABCA1 (Novus Biologicals, NB400-105, 1:1000), FLAG (Sigma, clone M2, 1:1000), GFP (Santa Cruz sc-9996, 1:500), Myc (Santa Cruz 9E10, 1:3000), HA (Covance, clone 16B12, ascites fluid, 1:6000), HMGCR (rabbit polyserum was a kind gift from Dr. Peter Edwards, UCLA), SREBP2 (BD Biosciences, clone 1C6, 1:1000), SREBP1 (ThermoFisher, clone 2A4, 1:1000), actin (Merck Millipore, clone C4, 1:5000), V5 (Invitrogen, 46–0705, 1:3000), RNF145 (Abgent AP18281b, 1:8000), and ubiquitin (Enzo life Sciences, clone FK2, 1:1000).

Techniques: Expressing, Cell Culture

( A ) RAW264.7 macrophages were treated with 5μg/mL Actinomycin D (ActD) for the indicated time and expression of Abca1 and Rnf145 was determined by qPCR and plotted as mean ± SD relative to untreated cells (n = 3), ( B ) HepG2 and RAW264.7 cells were treated with 1μM GW3965 for 6 hours in the presence or absence of 5μg/ml actinomycinD for 4 hours, after which expression of the indicated genes was measured by qPCR. Bars indicate mean ± SD (n = 3) ( C , D ) THP1 macrophages were cultured in sterol-depletion medium for 16 hrs and then treated with ( C ) 1μM GW3965 (GW) for the indicated time, or ( D ) with the indicated concentration of GW3965 for 4 hrs. Subsequently, gene expression was evaluated qPCR and bars indicate mean ± SD (n = 3)

Journal: PLoS ONE

Article Title: Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene

doi: 10.1371/journal.pone.0172721

Figure Lengend Snippet: ( A ) RAW264.7 macrophages were treated with 5μg/mL Actinomycin D (ActD) for the indicated time and expression of Abca1 and Rnf145 was determined by qPCR and plotted as mean ± SD relative to untreated cells (n = 3), ( B ) HepG2 and RAW264.7 cells were treated with 1μM GW3965 for 6 hours in the presence or absence of 5μg/ml actinomycinD for 4 hours, after which expression of the indicated genes was measured by qPCR. Bars indicate mean ± SD (n = 3) ( C , D ) THP1 macrophages were cultured in sterol-depletion medium for 16 hrs and then treated with ( C ) 1μM GW3965 (GW) for the indicated time, or ( D ) with the indicated concentration of GW3965 for 4 hrs. Subsequently, gene expression was evaluated qPCR and bars indicate mean ± SD (n = 3)

Article Snippet: Membranes were probed with the following antibodies: LDLR (Abcam, clone EP1553Y, 1:4000), tubulin (Sigma, clone DM1A, ascites fluid, 1:5000), ABCA1 (Novus Biologicals, NB400-105, 1:1000), FLAG (Sigma, clone M2, 1:1000), GFP (Santa Cruz sc-9996, 1:500), Myc (Santa Cruz 9E10, 1:3000), HA (Covance, clone 16B12, ascites fluid, 1:6000), HMGCR (rabbit polyserum was a kind gift from Dr. Peter Edwards, UCLA), SREBP2 (BD Biosciences, clone 1C6, 1:1000), SREBP1 (ThermoFisher, clone 2A4, 1:1000), actin (Merck Millipore, clone C4, 1:5000), V5 (Invitrogen, 46–0705, 1:3000), RNF145 (Abgent AP18281b, 1:8000), and ubiquitin (Enzo life Sciences, clone FK2, 1:1000).

Techniques: Expressing, Cell Culture, Concentration Assay, Gene Expression

( A ) LXR ChIP-seq experiments in human THP1 cells (GSE28319) and RAW macrophage-like cells (GSE50944) were analyzed and used to identify active LXREs within the Rnf145/Rnf145 loci, as graphically illustrated. ( B , C ) Genomic location of the identified LXREs. In bold, nucleotides that were mutated to disrupt LXR binding ( C ) A 1kb genomic region upstream of the transcriptional start site of hRNF145 was cloned into a pGL3basic. The putative LXRE was also mutated as indicated above. The empty, RNF145 WT , RNF145 MUT , and ABCA1 reporter plasmids were co-transfected with or without RXRα and LXRα expression plasmids in HEK 293T cells. 24 hours post-transfection the cells were treated with 1μM GW3965 (LXR) and 100nM LG100268 (RXR) for 24 hours and measured for luciferase signal (n≥3). ( D ) Cells were transfected with an empty or a tandem LXRE-containing pGL2 as in C . In all luciferase experiments the transfection efficiency was normalized to co-transfected Renilla luciferase. Bars report normalized chemiluminescence relative to untreated control ± SD (n = 3).

Journal: PLoS ONE

Article Title: Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene

doi: 10.1371/journal.pone.0172721

Figure Lengend Snippet: ( A ) LXR ChIP-seq experiments in human THP1 cells (GSE28319) and RAW macrophage-like cells (GSE50944) were analyzed and used to identify active LXREs within the Rnf145/Rnf145 loci, as graphically illustrated. ( B , C ) Genomic location of the identified LXREs. In bold, nucleotides that were mutated to disrupt LXR binding ( C ) A 1kb genomic region upstream of the transcriptional start site of hRNF145 was cloned into a pGL3basic. The putative LXRE was also mutated as indicated above. The empty, RNF145 WT , RNF145 MUT , and ABCA1 reporter plasmids were co-transfected with or without RXRα and LXRα expression plasmids in HEK 293T cells. 24 hours post-transfection the cells were treated with 1μM GW3965 (LXR) and 100nM LG100268 (RXR) for 24 hours and measured for luciferase signal (n≥3). ( D ) Cells were transfected with an empty or a tandem LXRE-containing pGL2 as in C . In all luciferase experiments the transfection efficiency was normalized to co-transfected Renilla luciferase. Bars report normalized chemiluminescence relative to untreated control ± SD (n = 3).

Article Snippet: Membranes were probed with the following antibodies: LDLR (Abcam, clone EP1553Y, 1:4000), tubulin (Sigma, clone DM1A, ascites fluid, 1:5000), ABCA1 (Novus Biologicals, NB400-105, 1:1000), FLAG (Sigma, clone M2, 1:1000), GFP (Santa Cruz sc-9996, 1:500), Myc (Santa Cruz 9E10, 1:3000), HA (Covance, clone 16B12, ascites fluid, 1:6000), HMGCR (rabbit polyserum was a kind gift from Dr. Peter Edwards, UCLA), SREBP2 (BD Biosciences, clone 1C6, 1:1000), SREBP1 (ThermoFisher, clone 2A4, 1:1000), actin (Merck Millipore, clone C4, 1:5000), V5 (Invitrogen, 46–0705, 1:3000), RNF145 (Abgent AP18281b, 1:8000), and ubiquitin (Enzo life Sciences, clone FK2, 1:1000).

Techniques: ChIP-sequencing, Binding Assay, Clone Assay, Transfection, Expressing, Luciferase, Control

Fig. 2. Caveolin partitioning to lipid raft/caveolae membrane domains in mouse primary macrophages. Lipid raft/caveolae membranes were isolated as described by Machleidt et al. (20). Cells were solubilized in 1% Triton X-100 and lipid raft/caveolae membrane fraction separated by centrifugation in a (10–30%) linear sucrose gradient. After centrifugation for 21 h in SW41 rotor fractions (1–14) were collected from the top and together with pelleted material (Pt) analyzed by SDS-PAGE and immunoblotting. Total protein loading after transfer to PVDF membrane was visualized by Ponceau S staining (A). Portion from each fraction was analyzed for alkaline phosphatase (AP) activity (lipid raft/caveolae marker) using an alkaline phosphatase substrate kit (Bio-Rad) (B). Caveolin-1, caveolin-2, -actin, and ABCA1 expression was analyzed by immuno- blotting (C). Rabbit anti-ABCA1 antibody was a gift from Michael L. Fitzgerald and Mason W. Freeman (Mas- sachusetts General Hospital and Harvard Medical School).

Journal: Journal of lipid research

Article Title: Caveolins and macrophage lipid metabolism.

doi: 10.1194/jlr.r200005-jlr200

Figure Lengend Snippet: Fig. 2. Caveolin partitioning to lipid raft/caveolae membrane domains in mouse primary macrophages. Lipid raft/caveolae membranes were isolated as described by Machleidt et al. (20). Cells were solubilized in 1% Triton X-100 and lipid raft/caveolae membrane fraction separated by centrifugation in a (10–30%) linear sucrose gradient. After centrifugation for 21 h in SW41 rotor fractions (1–14) were collected from the top and together with pelleted material (Pt) analyzed by SDS-PAGE and immunoblotting. Total protein loading after transfer to PVDF membrane was visualized by Ponceau S staining (A). Portion from each fraction was analyzed for alkaline phosphatase (AP) activity (lipid raft/caveolae marker) using an alkaline phosphatase substrate kit (Bio-Rad) (B). Caveolin-1, caveolin-2, -actin, and ABCA1 expression was analyzed by immuno- blotting (C). Rabbit anti-ABCA1 antibody was a gift from Michael L. Fitzgerald and Mason W. Freeman (Mas- sachusetts General Hospital and Harvard Medical School).

Article Snippet: Rabbit anti-ABCA1 antibody was a gift from Michael L. Fitzgerald and Mason W. Freeman (Massachusetts General Hospital and Harvard Medical School). at U niv of C onnecticut H lth C tr L M S tow e Lib, on June 9, 2015 w w w .jlr.org D ow nloaded from

Techniques: Membrane, Isolation, Centrifugation, SDS Page, Western Blot, Staining, Activity Assay, Marker, Expressing

Fig. 3. Role of caveolin and lipid raft domains in cholesterol efflux from macrophages. Plasma membrane cholesterol in the lipid rafts is surrounded by sphingolipids in a tight, liquid-ordered state and is highly resistant to extraction by nonionic detergents. Lipid raft choles- terol as well as other lipids and associated proteins (e.g., caveolin-1) may be released to the medium by membrane shedding in an acceptor- independent manner. Albeit at higher concentrations, the highly insoluble cholesterol in the lipid rafts is an unfavorable source for acceptor- mediated efflux, which takes place primarily in the non-raft, liquid disordered membranes. In passive diffusion, cholesterol is desorbed from the cell surface to an acceptor along the concentration gradient in an energy-independent manner. The second, energy- and acceptor- dependent mechanism is mediated by the ABCA1 transporter, and involves primarily the transport of cholesterol from intracellular pools to lipid-poor apo-AI. A third mechanism of cholesterol efflux, operating in macrophages, is mediated via HDL retro-endocytosis by interacting with intracellular lipid-rich pools. Retro-endocytosis is also a likely mechanism by which HDL in macrophages can acquire apoE and Golgi- associated non-raft cav-2 and cav-1. Increased cAMP production plays a major coordinating role in the removal of intracellular cholesterol by stimulating the NCEH, ABCA1 transcription, and apoE secretion.

Journal: Journal of lipid research

Article Title: Caveolins and macrophage lipid metabolism.

doi: 10.1194/jlr.r200005-jlr200

Figure Lengend Snippet: Fig. 3. Role of caveolin and lipid raft domains in cholesterol efflux from macrophages. Plasma membrane cholesterol in the lipid rafts is surrounded by sphingolipids in a tight, liquid-ordered state and is highly resistant to extraction by nonionic detergents. Lipid raft choles- terol as well as other lipids and associated proteins (e.g., caveolin-1) may be released to the medium by membrane shedding in an acceptor- independent manner. Albeit at higher concentrations, the highly insoluble cholesterol in the lipid rafts is an unfavorable source for acceptor- mediated efflux, which takes place primarily in the non-raft, liquid disordered membranes. In passive diffusion, cholesterol is desorbed from the cell surface to an acceptor along the concentration gradient in an energy-independent manner. The second, energy- and acceptor- dependent mechanism is mediated by the ABCA1 transporter, and involves primarily the transport of cholesterol from intracellular pools to lipid-poor apo-AI. A third mechanism of cholesterol efflux, operating in macrophages, is mediated via HDL retro-endocytosis by interacting with intracellular lipid-rich pools. Retro-endocytosis is also a likely mechanism by which HDL in macrophages can acquire apoE and Golgi- associated non-raft cav-2 and cav-1. Increased cAMP production plays a major coordinating role in the removal of intracellular cholesterol by stimulating the NCEH, ABCA1 transcription, and apoE secretion.

Article Snippet: Rabbit anti-ABCA1 antibody was a gift from Michael L. Fitzgerald and Mason W. Freeman (Massachusetts General Hospital and Harvard Medical School). at U niv of C onnecticut H lth C tr L M S tow e Lib, on June 9, 2015 w w w .jlr.org D ow nloaded from

Techniques: Clinical Proteomics, Membrane, Extraction, Diffusion-based Assay, Concentration Assay

Treg exp increase ABCA1 expression by transferring cAMP into M IL4 . (A) Changes in the expression of ABCA1 and ABCG1 transcripts in M IL4 co-cultured with either Teffs or Treg exp . Gene expression quantified by qRT-PCR comparing mRNA levels in M IL4 alone (RQ = 1, shown as dashed line) with the same cells co-cultured for 4h with either Teffs or Tregs. UBC was used as reference gene. (B) Intracellular concentration of cAMP in Tregs exp alone, M IL4 alone, or M IL4 co-cultured with Tregs exp for 4h. cAMP levels were normalized to total cellular protein content. Statistical analysis was performed only between M IL4 and M IL4 + Tregs exp , as the aim was to assess whether cAMP levels in M IL4 increase upon co-culture. The cAMP level in Tregs exp is shown as a reference to highlight the high concentration of this molecule in these cells but was not included in the statistical comparison due to the difference in cell type. (C) Changes in the expression of ABCA1 mRNA in M IL4 co-cultured with Treg exp (ratio 1:1) after 1h preincubation or not with GAP27 (300 µM). (D) Changes in the expression of ABCA1 mRNA in M IL4 co-cultured with Tregs (ratio 1:1) after 1h preincubation or not with PKA inhibitor H89 (5 µM). (E) Western blot analysis of ABCA1 protein level in cell lysates of M IL4 alone or M IL4 co-cultured (ratio 1:1) with either Treg exp or Teff for 4h. Data were plotted as ABCA1 protein intensity normalised to GAPDH protein intensity. Statistical analysis was performed using one-way ANOVA followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01.

Journal: Frontiers in Immunology

Article Title: Ex vivo expanded human regulatory T cells promote cholesterol efflux and PON1 expression in oxLDL-exposed macrophages via gap junction-mediated cAMP transfer

doi: 10.3389/fimmu.2025.1662925

Figure Lengend Snippet: Treg exp increase ABCA1 expression by transferring cAMP into M IL4 . (A) Changes in the expression of ABCA1 and ABCG1 transcripts in M IL4 co-cultured with either Teffs or Treg exp . Gene expression quantified by qRT-PCR comparing mRNA levels in M IL4 alone (RQ = 1, shown as dashed line) with the same cells co-cultured for 4h with either Teffs or Tregs. UBC was used as reference gene. (B) Intracellular concentration of cAMP in Tregs exp alone, M IL4 alone, or M IL4 co-cultured with Tregs exp for 4h. cAMP levels were normalized to total cellular protein content. Statistical analysis was performed only between M IL4 and M IL4 + Tregs exp , as the aim was to assess whether cAMP levels in M IL4 increase upon co-culture. The cAMP level in Tregs exp is shown as a reference to highlight the high concentration of this molecule in these cells but was not included in the statistical comparison due to the difference in cell type. (C) Changes in the expression of ABCA1 mRNA in M IL4 co-cultured with Treg exp (ratio 1:1) after 1h preincubation or not with GAP27 (300 µM). (D) Changes in the expression of ABCA1 mRNA in M IL4 co-cultured with Tregs (ratio 1:1) after 1h preincubation or not with PKA inhibitor H89 (5 µM). (E) Western blot analysis of ABCA1 protein level in cell lysates of M IL4 alone or M IL4 co-cultured (ratio 1:1) with either Treg exp or Teff for 4h. Data were plotted as ABCA1 protein intensity normalised to GAPDH protein intensity. Statistical analysis was performed using one-way ANOVA followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01.

Article Snippet: Equal amounts of total protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF) membrane and probed overnight at 4C with the respective antibodies: monoclonal anti-ABCA1 antibody (CellSignaling; Cat Number 96292), polyclonal anti-PON1 antibody (Proteintech; Cat Number 18155-1-AP), monoclonal anti-GAPDH antibody (CellSignaling; Cat Number 5174), recombinant monoclonal anti-ABCA1 (phosho-S2054) antibody (Abcam; Cat Number ab125064).

Techniques: Expressing, Transferring, Cell Culture, Gene Expression, Quantitative RT-PCR, Concentration Assay, Co-Culture Assay, Comparison, Western Blot

FIG. 3. ABCA1 overexpression inhibits A secretion. A, ABCA1 protein in Neuro2a cells after LXR activation (top panel) or transient transfection (bottom panel), showing similar expression levels relative to actin. B and C, A peptide in medium was determined by immunopre- cipitation and immunoblotting; cellular APP (cAPP) was determined by immunoblotting cell lysates. The bar graphs show combined data from three or more independent experiments. *, p 0.01 compared with mock (mk) control. B, Neuro2a-APPSw cells were transfected with either mock control plasmid or ABCA1 cDNA. ApoA-I (A1) was added for 6 h where indicated. C, Neuro2a-APPsw cells were transfected with empty vector (control) or vector containing ABCA1 cDNA or ABCA1 with a mutation in the ATP-binding cassette (Walker motif mutation). Filled bar, no apolipoprotein added; hatched bar, apoA-I added.

Journal: Journal of Biological Chemistry

Article Title: Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid β Peptide Secretion

doi: 10.1074/jbc.m300760200

Figure Lengend Snippet: FIG. 3. ABCA1 overexpression inhibits A secretion. A, ABCA1 protein in Neuro2a cells after LXR activation (top panel) or transient transfection (bottom panel), showing similar expression levels relative to actin. B and C, A peptide in medium was determined by immunopre- cipitation and immunoblotting; cellular APP (cAPP) was determined by immunoblotting cell lysates. The bar graphs show combined data from three or more independent experiments. *, p 0.01 compared with mock (mk) control. B, Neuro2a-APPSw cells were transfected with either mock control plasmid or ABCA1 cDNA. ApoA-I (A1) was added for 6 h where indicated. C, Neuro2a-APPsw cells were transfected with empty vector (control) or vector containing ABCA1 cDNA or ABCA1 with a mutation in the ATP-binding cassette (Walker motif mutation). Filled bar, no apolipoprotein added; hatched bar, apoA-I added.

Article Snippet: Polyclonal anti-ABCA1 antibody was purchased from Novus (Littleton, CO).

Techniques: Over Expression, Activation Assay, Transfection, Expressing, Western Blot, Control, Plasmid Preparation, Mutagenesis, Binding Assay

FIG. 4. The effect of apoE isoforms on A secretion. Neuro2a- APPSw cells were transfected with empty vector (control) or ABCA1 vector, and apoE isoforms were added during the last 6 h of the exper- iment; data are the means S.E. for five separate experiments con- ducted in duplicate or triplicate. *, p 0.01 compared with mock transfected; #, p 0.05 compared with ABCA1 transfected without apolipoprotein.

Journal: Journal of Biological Chemistry

Article Title: Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid β Peptide Secretion

doi: 10.1074/jbc.m300760200

Figure Lengend Snippet: FIG. 4. The effect of apoE isoforms on A secretion. Neuro2a- APPSw cells were transfected with empty vector (control) or ABCA1 vector, and apoE isoforms were added during the last 6 h of the exper- iment; data are the means S.E. for five separate experiments con- ducted in duplicate or triplicate. *, p 0.01 compared with mock transfected; #, p 0.05 compared with ABCA1 transfected without apolipoprotein.

Article Snippet: Polyclonal anti-ABCA1 antibody was purchased from Novus (Littleton, CO).

Techniques: Transfection, Plasmid Preparation, Control

FIG. 5. ABCA1 overexpression decreases -cleavage of APPSw and -cleavage of the 99-amino acid C-terminal fragment of APP. A, Neuro2a-APPSw cells were transfected with either empty vector or vector containing ABCA1 cDNA. The -cleavage product C99 was detected by immunoprecipitation of cell lysates with antibody 4G8 followed by immunoblotting with 6E10. Cellular APP (cAPP) level was measured by immunoblotting cell lysates. The data are the means S.E. for five separate experiments; *, p 0.01 compared with mock (mk) transfected. B, Neuro2a cells were transfected with vector containing either C99 Myc alone or C99 Myc with ABCA1. A was detected as in Fig. 3. Cellular C99 was detected by immunoprecipitation with anti-Myc antibody followed by Western blot with 6E10. The data are shown for three separate experiments conducted in duplicate. #, p 0.05 compared with C99 transfected alone.

Journal: Journal of Biological Chemistry

Article Title: Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid β Peptide Secretion

doi: 10.1074/jbc.m300760200

Figure Lengend Snippet: FIG. 5. ABCA1 overexpression decreases -cleavage of APPSw and -cleavage of the 99-amino acid C-terminal fragment of APP. A, Neuro2a-APPSw cells were transfected with either empty vector or vector containing ABCA1 cDNA. The -cleavage product C99 was detected by immunoprecipitation of cell lysates with antibody 4G8 followed by immunoblotting with 6E10. Cellular APP (cAPP) level was measured by immunoblotting cell lysates. The data are the means S.E. for five separate experiments; *, p 0.01 compared with mock (mk) transfected. B, Neuro2a cells were transfected with vector containing either C99 Myc alone or C99 Myc with ABCA1. A was detected as in Fig. 3. Cellular C99 was detected by immunoprecipitation with anti-Myc antibody followed by Western blot with 6E10. The data are shown for three separate experiments conducted in duplicate. #, p 0.05 compared with C99 transfected alone.

Article Snippet: Polyclonal anti-ABCA1 antibody was purchased from Novus (Littleton, CO).

Techniques: Over Expression, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot

Figure 9. MCPIP1 deficiency increased macrophage cholesterol efflux. A. Bone marrow-derived macrophages were loaded with ac-LDL and cholesterol efflux to DMEM, apoAI and HDL was measured. Data were presented as mean 6 SEM. N = 3 in each group. B. Bone marrow-derived macrophages were cultured in DMEM for 48 h with or without ac-LDL. Cell lysates were used for western blotting analysis for ABCA1 and ABCG1. Representative western blotting result was shown. C. Quantitative analysis of the western blots. Data were presented as mean 6 SEM. N = 4 in each group. Open column: WT macrophages; Black column, MCPIP12/2 macrophages. doi:10.1371/journal.pone.0080089.g009

Journal: PloS one

Article Title: Bone marrow deficiency of MCPIP1 results in severe multi-organ inflammation but diminishes atherogenesis in hyperlipidemic mice.

doi: 10.1371/journal.pone.0080089

Figure Lengend Snippet: Figure 9. MCPIP1 deficiency increased macrophage cholesterol efflux. A. Bone marrow-derived macrophages were loaded with ac-LDL and cholesterol efflux to DMEM, apoAI and HDL was measured. Data were presented as mean 6 SEM. N = 3 in each group. B. Bone marrow-derived macrophages were cultured in DMEM for 48 h with or without ac-LDL. Cell lysates were used for western blotting analysis for ABCA1 and ABCG1. Representative western blotting result was shown. C. Quantitative analysis of the western blots. Data were presented as mean 6 SEM. N = 4 in each group. Open column: WT macrophages; Black column, MCPIP12/2 macrophages. doi:10.1371/journal.pone.0080089.g009

Article Snippet: Rabbit antimouse ABCA1 and anti-mouse ABCG1 antibodies were from Novus Biologicals (Littleton, CO).

Techniques: Derivative Assay, Cell Culture, Western Blot

FIGURE 1. Gene silencing of OSBP increases ABCA1 expression. A, CHO cells stably expressing an shOSBP or a nontargeting control (shNT) were treated with solvent (no addition (NA)), 10 nM RA alone, or 22OH or 25OH (0.125–1.0 g/ml) plus 10 nM RA for 18 h. Cell lysates were resolved by 6–10% SDS-PAGE and analyzed by immunoblotting using primary antibodies against OSBP, ABCA1, and tubulin (Tub). B, shNT and shOSBP cells were treated with solvent (NA) or 22OH (1.0 g/ml) with and without RA for 0–12 h. Cells lysates were analyzed by immunoblotting with primary antibodies against ABCA1 and actin. The extent of OSBP knockdown in shOSBP cells was similar to results in A. C, CHO cells were transfected with siOSBP (25 nM) or siNT for 48 h. Cells were treated with 22OH or 25OH (1.0 g/ml) with or without RA (10 nM) for 18 h. Whole cell lysates were resolved by SDS-PAGE and immunoblotted using antibodies against ABCA1 and OSBP. D, J774 macrophages were transfected with siNT or siOSBP for 48 h and treated with 22OH (1 g/ml) or TO091317 (TO) (1 M) with RA (10 nM) for 18 h prior to immunoblotting for ABCA1, OSBP, and actin.

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 1. Gene silencing of OSBP increases ABCA1 expression. A, CHO cells stably expressing an shOSBP or a nontargeting control (shNT) were treated with solvent (no addition (NA)), 10 nM RA alone, or 22OH or 25OH (0.125–1.0 g/ml) plus 10 nM RA for 18 h. Cell lysates were resolved by 6–10% SDS-PAGE and analyzed by immunoblotting using primary antibodies against OSBP, ABCA1, and tubulin (Tub). B, shNT and shOSBP cells were treated with solvent (NA) or 22OH (1.0 g/ml) with and without RA for 0–12 h. Cells lysates were analyzed by immunoblotting with primary antibodies against ABCA1 and actin. The extent of OSBP knockdown in shOSBP cells was similar to results in A. C, CHO cells were transfected with siOSBP (25 nM) or siNT for 48 h. Cells were treated with 22OH or 25OH (1.0 g/ml) with or without RA (10 nM) for 18 h. Whole cell lysates were resolved by SDS-PAGE and immunoblotted using antibodies against ABCA1 and OSBP. D, J774 macrophages were transfected with siNT or siOSBP for 48 h and treated with 22OH (1 g/ml) or TO091317 (TO) (1 M) with RA (10 nM) for 18 h prior to immunoblotting for ABCA1, OSBP, and actin.

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Expressing, Stable Transfection, Control, Solvent, SDS Page, Western Blot, Knockdown, Transfection

FIGURE 2. siRNA depletion of OSBP increases cholesterol efflux to apoAI. CHO cells were transiently trans- fected with siOSBP or siNT (25 nM). The following day, cells were loaded with [3H]cholesterol and received no addition (NA), 22OH (1.0 g/ml) plus 10 M RA, or 1 M TO901317 (TO). After 18 h, ABCA1 protein expression and [3H]cholesterol efflux to apoAI was measured as described under “Experimental Procedures.” A, total lysates from cells treated for 1 h with apoAI were resolved by SDS-PAGE and immunoblotted for ABCA1, OSBP, and actin. B, ABCA1 protein expression was quantified by densitometry and expressed relative to actin. Results are the mean and S.E. for three separate experiments. C, ApoAI-specific efflux of [3H]cholesterol was measured at 1 h. Results are the mean and S.E. of three separate experiments (*, p 0.05).

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 2. siRNA depletion of OSBP increases cholesterol efflux to apoAI. CHO cells were transiently trans- fected with siOSBP or siNT (25 nM). The following day, cells were loaded with [3H]cholesterol and received no addition (NA), 22OH (1.0 g/ml) plus 10 M RA, or 1 M TO901317 (TO). After 18 h, ABCA1 protein expression and [3H]cholesterol efflux to apoAI was measured as described under “Experimental Procedures.” A, total lysates from cells treated for 1 h with apoAI were resolved by SDS-PAGE and immunoblotted for ABCA1, OSBP, and actin. B, ABCA1 protein expression was quantified by densitometry and expressed relative to actin. Results are the mean and S.E. for three separate experiments. C, ApoAI-specific efflux of [3H]cholesterol was measured at 1 h. Results are the mean and S.E. of three separate experiments (*, p 0.05).

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Expressing, SDS Page

FIGURE 4. Gene silencing of OSBP does not alter ABCA1 mRNA levels or LXR activity. CHO cells were transiently transfected with siNT or siOSBP (25 nM) duplexes for 24 h. Cells then received medium with no addition (solvent, NA), 22OH (1.0 g/ml) plus 10 nM RA, or 1.0 M TO901317 plus RA for 18 h. A and B, total RNA was isolated from cells, and ABCA1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) message levels were quantified by S1 nuclease protection assay and densitometry of autoradiograms. Results are the mean and S.E. of five separate experiments. C, LXR activity was measured using the pGL3-LXREX3 reporter construct as described under “Experimental Procedures.” Results are the mean and S.E. of three separate experiments.

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 4. Gene silencing of OSBP does not alter ABCA1 mRNA levels or LXR activity. CHO cells were transiently transfected with siNT or siOSBP (25 nM) duplexes for 24 h. Cells then received medium with no addition (solvent, NA), 22OH (1.0 g/ml) plus 10 nM RA, or 1.0 M TO901317 plus RA for 18 h. A and B, total RNA was isolated from cells, and ABCA1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) message levels were quantified by S1 nuclease protection assay and densitometry of autoradiograms. Results are the mean and S.E. of five separate experiments. C, LXR activity was measured using the pGL3-LXREX3 reporter construct as described under “Experimental Procedures.” Results are the mean and S.E. of three separate experiments.

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Activity Assay, Transfection, Solvent, Isolation, Construct

FIGURE 5. RNA interference depletion of OSBP decreases ABCA1 protein turnover. CHO cells were transfected with siNT or siOSBP and treated with TO901317 (1 M) for 18 h. A, cells received medium containing cycloheximide (CHX) (20 g/ml) at t 0 and at the indicated time points were analyzed for expression of ABCA1, OSBP, and actin by immunoblotting. B, ABCA1 protein was quantified by densitometry, normalized to actin, and expressed relative to untreated cells. Results are the mean and S.E. of three or four separate experiments.

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 5. RNA interference depletion of OSBP decreases ABCA1 protein turnover. CHO cells were transfected with siNT or siOSBP and treated with TO901317 (1 M) for 18 h. A, cells received medium containing cycloheximide (CHX) (20 g/ml) at t 0 and at the indicated time points were analyzed for expression of ABCA1, OSBP, and actin by immunoblotting. B, ABCA1 protein was quantified by densitometry, normalized to actin, and expressed relative to untreated cells. Results are the mean and S.E. of three or four separate experiments.

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Transfection, Expressing, Western Blot

FIGURE 6. The proportion of ABCA1 at the plasma membrane is not increased by OSBP depletion. CHO cells were transfected with siNT or siOSBP duplexes (25 nM) for 48 h and received no addition (NA) or 1 M TO901317 (TO) for 18 h. The proportion of ABCA1, OSBP, protein kinase D (PKD), and AKT in total cell lysates and PM (isolated from 2 total cell lysate) was determined by surface biotinylation and immunoblotting. Similar results were observed in two other experiments.

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 6. The proportion of ABCA1 at the plasma membrane is not increased by OSBP depletion. CHO cells were transfected with siNT or siOSBP duplexes (25 nM) for 48 h and received no addition (NA) or 1 M TO901317 (TO) for 18 h. The proportion of ABCA1, OSBP, protein kinase D (PKD), and AKT in total cell lysates and PM (isolated from 2 total cell lysate) was determined by surface biotinylation and immunoblotting. Similar results were observed in two other experiments.

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Clinical Proteomics, Membrane, Transfection, Isolation, Western Blot

FIGURE 7. Sphingomyelin metabolism and localization in OSBP-depleted cells is not correlated with ABCA1 expression. A, CHO cells were trans- fected with siOSBP (black bars) or siNT (gray bars) for 48 h, followed by treat- ment with solvent (no addition (NA)), 22OH (2 g/ml) plus 10 nM RA, 25OH (2 g/ml) plus 10 nM RA, TO901317 (1 M), or 10 nM RA for 18 h. Cells were then pulse-labeled with [3H]serine (10 Ci/ml) for 4 h in serine-free medium A, and isotope incorporation into SM and glucosylceramide (GlcCer) was quantified as previously described (52). Results are the mean and S.E. of three experi- ments. B, CHO cells were transfected and treated as described in A except that [3H]choline (2 Ci/ml) was added for 24 h to label the SM and phosphatidyl- choline(PC)poolstoequilibrium.Cellswerethentreatedwithbacterialsphin- gomyelinase (50 milliunits/ml) for 30 min, and [3H]SM and [3H]PC were iso- lated and quantified. The percentage of [3H]SM remaining after sphingomyelinase (SMase) treatment relative to untreated cells was normal- ized to both cellular proteins and [3H]PC. Results are the mean and S.E. of three experiments. C, the amount of [3H]SM in control and sphingomyelinase treated cells (normalized to [3H]PC) is shown for the three experiments (mean and S.E.) from B (*, p 0.05 compared with corresponding siNT-transfected cells).

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 7. Sphingomyelin metabolism and localization in OSBP-depleted cells is not correlated with ABCA1 expression. A, CHO cells were trans- fected with siOSBP (black bars) or siNT (gray bars) for 48 h, followed by treat- ment with solvent (no addition (NA)), 22OH (2 g/ml) plus 10 nM RA, 25OH (2 g/ml) plus 10 nM RA, TO901317 (1 M), or 10 nM RA for 18 h. Cells were then pulse-labeled with [3H]serine (10 Ci/ml) for 4 h in serine-free medium A, and isotope incorporation into SM and glucosylceramide (GlcCer) was quantified as previously described (52). Results are the mean and S.E. of three experi- ments. B, CHO cells were transfected and treated as described in A except that [3H]choline (2 Ci/ml) was added for 24 h to label the SM and phosphatidyl- choline(PC)poolstoequilibrium.Cellswerethentreatedwithbacterialsphin- gomyelinase (50 milliunits/ml) for 30 min, and [3H]SM and [3H]PC were iso- lated and quantified. The percentage of [3H]SM remaining after sphingomyelinase (SMase) treatment relative to untreated cells was normal- ized to both cellular proteins and [3H]PC. Results are the mean and S.E. of three experiments. C, the amount of [3H]SM in control and sphingomyelinase treated cells (normalized to [3H]PC) is shown for the three experiments (mean and S.E.) from B (*, p 0.05 compared with corresponding siNT-transfected cells).

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Expressing, Solvent, Labeling, Transfection, Control

FIGURE 8. Increased turnover of ABCA1 by OSBP involves the sterol-bind- ing domain. CHO cells were co-transfected with pCMV-ABCA1-FLAG (1 g) and 0, 1, 2, or 3 g of plasmid encoding wild-type OSBP (f), sterol-binding (OSBP-SB) (Œ), PH domain (OSBP-PH) (), or FFAT domain (OSBP-FF/AA) () mutants. Cells were harvested after 24 h, and expression of ABCA1, OSBP, and actin was analyzed by immunoblotting (A), quantified by densitometry (B), normalized to actin, and expressed relative to cells that were not trans- fected with OSBP plasmids. Expression of endogenous ABCA1 was deter- minedinmock-transfectedcellsandsubtracted.ResultsarethemeanandS.E. for three separate experiments.

Journal: Journal of Biological Chemistry

Article Title: OSBP Negatively Regulates ABCA1 Protein Stability

doi: 10.1074/jbc.m800918200

Figure Lengend Snippet: FIGURE 8. Increased turnover of ABCA1 by OSBP involves the sterol-bind- ing domain. CHO cells were co-transfected with pCMV-ABCA1-FLAG (1 g) and 0, 1, 2, or 3 g of plasmid encoding wild-type OSBP (f), sterol-binding (OSBP-SB) (Œ), PH domain (OSBP-PH) (), or FFAT domain (OSBP-FF/AA) () mutants. Cells were harvested after 24 h, and expression of ABCA1, OSBP, and actin was analyzed by immunoblotting (A), quantified by densitometry (B), normalized to actin, and expressed relative to cells that were not trans- fected with OSBP plasmids. Expression of endogenous ABCA1 was deter- minedinmock-transfectedcellsandsubtracted.ResultsarethemeanandS.E. for three separate experiments.

Article Snippet: Following transfer to nitrocellulose, filters were probed with primary antibodies against ABCA1 (Novus Biologicals, Littleton, CO), OSBP, and actin, followed by goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated secondary antibodies.

Techniques: Transfection, Plasmid Preparation, Binding Assay, Expressing, Western Blot