aav9 snca shrna Search Results


aav9 snca shrna  (Vector Biolabs)
94
Vector Biolabs aav9 snca shrna
Mouse primary cortical neurons were transduced at DIV 1 with Snca knockdown <t>AAV9-shRNA</t> or AAV1/2-miRNA and respective scramble control sequences in the titers indicated. ( A ) At DIV 15, significant reduction in aSyn levels in AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures was detected, as compared to the respective SCR-control-treated cultures. Alpha-synuclein protein levels were detected by ELISA and data are presented as mean ± SD of three (3) independent experiments. Comparisons were made using Two-way ANOVA followed by Tukey’s post hoc test, asterisks indicate significance (*p < 0.05, ** p < 0.01, ****p < 0.0001). ( B-C ) At DIV 7, neurons were treated with haSyn PFFs (1 ng/µl) and processed for pSer129-aSyn immunocytochemistry to reveal seeded aSyn aggregation at DIV 15. Representative confocal images (20x objective, upper panels ) of nuclei stained with Hoechst (in gray), and pSer129 alpha-synuclein immunoreactivity (in red) and respective graphs ( bottom panels ) of AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures are shown. Scale bar = 580 µm. Quantifications of pSer129-aSyn immunoreactivity are shown as Spot Total Intensity/viable cell count as mean ± SD of five (5) independent experiments. Comparisons were made using Two-way ANOVA with Tukey’s post hoc test, asterisks indicate significance (*p < 0.05, ** p < 0.01, *** p < 0.001, ****p < 0.0001). ( D ) Quantifications of the number of intact nuclei in AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures, in the presence of haSyn PFFs at DIV 15. A one-way ANOVA followed by Tukey’s post hoc test was used to assess differences in the number of healthy nuclei among groups with different titers within the same AAV serotype. No significant differences were observed in the number of healthy nuclei between any groups in both AAV1/2 and AAV9 constructs (n=5).
Aav9 Snca Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav9 snca shrna/product/Vector Biolabs
Average 94 stars, based on 1 article reviews
aav9 snca shrna - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


Mouse primary cortical neurons were transduced at DIV 1 with Snca knockdown AAV9-shRNA or AAV1/2-miRNA and respective scramble control sequences in the titers indicated. ( A ) At DIV 15, significant reduction in aSyn levels in AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures was detected, as compared to the respective SCR-control-treated cultures. Alpha-synuclein protein levels were detected by ELISA and data are presented as mean ± SD of three (3) independent experiments. Comparisons were made using Two-way ANOVA followed by Tukey’s post hoc test, asterisks indicate significance (*p < 0.05, ** p < 0.01, ****p < 0.0001). ( B-C ) At DIV 7, neurons were treated with haSyn PFFs (1 ng/µl) and processed for pSer129-aSyn immunocytochemistry to reveal seeded aSyn aggregation at DIV 15. Representative confocal images (20x objective, upper panels ) of nuclei stained with Hoechst (in gray), and pSer129 alpha-synuclein immunoreactivity (in red) and respective graphs ( bottom panels ) of AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures are shown. Scale bar = 580 µm. Quantifications of pSer129-aSyn immunoreactivity are shown as Spot Total Intensity/viable cell count as mean ± SD of five (5) independent experiments. Comparisons were made using Two-way ANOVA with Tukey’s post hoc test, asterisks indicate significance (*p < 0.05, ** p < 0.01, *** p < 0.001, ****p < 0.0001). ( D ) Quantifications of the number of intact nuclei in AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures, in the presence of haSyn PFFs at DIV 15. A one-way ANOVA followed by Tukey’s post hoc test was used to assess differences in the number of healthy nuclei among groups with different titers within the same AAV serotype. No significant differences were observed in the number of healthy nuclei between any groups in both AAV1/2 and AAV9 constructs (n=5).

Journal: bioRxiv

Article Title: In vivo validation of novel non-invasive PHP.eB AAVs as a potential therapeutic approach for alpha-Synucleinopathies

doi: 10.1101/2025.05.16.653961

Figure Lengend Snippet: Mouse primary cortical neurons were transduced at DIV 1 with Snca knockdown AAV9-shRNA or AAV1/2-miRNA and respective scramble control sequences in the titers indicated. ( A ) At DIV 15, significant reduction in aSyn levels in AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures was detected, as compared to the respective SCR-control-treated cultures. Alpha-synuclein protein levels were detected by ELISA and data are presented as mean ± SD of three (3) independent experiments. Comparisons were made using Two-way ANOVA followed by Tukey’s post hoc test, asterisks indicate significance (*p < 0.05, ** p < 0.01, ****p < 0.0001). ( B-C ) At DIV 7, neurons were treated with haSyn PFFs (1 ng/µl) and processed for pSer129-aSyn immunocytochemistry to reveal seeded aSyn aggregation at DIV 15. Representative confocal images (20x objective, upper panels ) of nuclei stained with Hoechst (in gray), and pSer129 alpha-synuclein immunoreactivity (in red) and respective graphs ( bottom panels ) of AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures are shown. Scale bar = 580 µm. Quantifications of pSer129-aSyn immunoreactivity are shown as Spot Total Intensity/viable cell count as mean ± SD of five (5) independent experiments. Comparisons were made using Two-way ANOVA with Tukey’s post hoc test, asterisks indicate significance (*p < 0.05, ** p < 0.01, *** p < 0.001, ****p < 0.0001). ( D ) Quantifications of the number of intact nuclei in AAV9-shRNA-( left ) or AAV1/2-miRNA-( right ) treated cultures, in the presence of haSyn PFFs at DIV 15. A one-way ANOVA followed by Tukey’s post hoc test was used to assess differences in the number of healthy nuclei among groups with different titers within the same AAV serotype. No significant differences were observed in the number of healthy nuclei between any groups in both AAV1/2 and AAV9 constructs (n=5).

Article Snippet: We used AAV9-Snca-shRNA (cat. # shAAV-272717) containing a 1:1 mixture of 2 mouse Snca-shRNA sequences #106636 and #272292 (#106636 5’-CCGGGTCCTCTATGTAGGTTCCAAACTCGAGTTTGGAACCTACATAGAGGACT TTTT-3’ and #272292 5’-CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTT TTTT-3’) and scramble control-shRNA (cat. # 7045) from Vector Biolabs (Malvern, PA 19355, USA) at final titers of 10×10^9, 4×10^9, and 1.6×10^9 virus particles/well and AAV1/2-Snca-3xmiRNA (cat. # GD1009-RV-M) containing three mouse Snca miRNA sequences aSyn (244): 5’-TATATTCCCAGCTCCCTCCACGTTTTGGCCACTGACTGACGTGGAGGGCTGGG AATATA-3’, aSyn (327): 5’ ATGTCTTCCAGGATTCCTTCCGTTTTGGCCACTGACTGACGGAAGGAACTGGA AGACAT-3’ and aSyn (397): 5’-TTCAGGCTCATAGTCTTGGTAGTTTTGGCCACTGACTGACTACCAAGAATGAG CCTGAA-3’ and scramble control miRNA (cat. # GD1009-RV-C) from Vigene Biosciences (Vigene Biosciences, Rockville, MD 20850, USA) at final titers of 5.5×10^7, 2.75×10^7, and 0.55×10^7 virus particles/well.

Techniques: Knockdown, shRNA, Control, Enzyme-linked Immunosorbent Assay, Immunocytochemistry, Staining, Cell Counting, Construct