a23187 Search Results


91
Alomone Labs a23187
A23187, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/A23187/pm32194132-81-0-3
Average 91 stars, based on 1 article reviews
a23187 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

92
MedChemExpress 4 bromo a23187
4 Bromo A23187, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/4-Bromo+A23187/pm38514666-324-55-57
Average 92 stars, based on 1 article reviews
4 bromo a23187 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology a23187
A23187, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/A23187/pm15581619-26-0-23
Average 93 stars, based on 1 article reviews
a23187 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

95
MedChemExpress calcimycin
Calcimycin, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/Calcimycin/10__20517_slash_evcna__2026__36-110-18-20
Average 95 stars, based on 1 article reviews
calcimycin - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

92
Cell Signaling Technology Inc ca 2 i a23187
Size distribution of washed platelets from healthy adult volunteers (A) treated with Ca2+ (1 mM) and <t>A23187</t> (B) treated with Ca2+ (1 mM) and DMSO (vehicle).
Ca 2 I A23187, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/A23187/pmc11144119-68-24-9
Average 92 stars, based on 1 article reviews
ca 2 i a23187 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
Thermo Fisher ca2 ionophore a23187
FIG. 1. Hypothetical pathway of cal- pain activation in the <t>Ca2-induced</t> apoptotic mechanism. Ca2 enters the photoreceptor outer segment via the cGMP-gated channels and activates cal- pain, promoting the cleavage of the Bcl-2 family protein, bid, which targets the mi- tochondria. Cytochrome c release from the mitochondria into the cytosol is trig- gered by the preceding events, promoting the interaction of Apaf-1 and caspase-9 subsequently leading to caspase-3 activa- tion, which cleaves the DNA into high molecular weight fragments and results in morphological apoptosis. PARP, poly- (ADP)-ribose polymerase.
Ca2 Ionophore A23187, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/A23187%2C+98%25%2C+free+acid/10__1074_slash_jbc__m401037200-58-8-11
Average 92 stars, based on 1 article reviews
ca2 ionophore a23187 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

95
Tocris ca2þ ionophore a23187
Figure 4. Menopause does not change structural properties of cerebral parenchymal arterioles. Summary graphs show- ing that outer diameter (A), lumen diameter (B), wall thick- ness (C), and wall-to-lumen ratio (D) in parenchymal arterioles were unchanged by menopause. Data are means ± SE; N = 8 to 8 arterioles from 8 mice/group, ana- lyzed by 2-way ANOVA with a Bonferroni post hoc correction for multiple comparisons. Passive structural measurements were obtained in pressurized arterioles incubated in <t>Ca2þ-</t> free conditions with addition of vasodilators to the superfus- ing bath.
Ca2þ Ionophore A23187, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/A23187%2C+free+acid/pm36149767-111-4-9
Average 95 stars, based on 1 article reviews
ca2þ ionophore a23187 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

94
Thermo Fisher ionophore a23187
(A) Schematic representation of the optogenetic system containing multivalent C1B1-MP, Cry2-αGFP, and a membrane anchored PM-GFP. Upon exposure to blue light, Cry2-αGFP can interact with itself and/or CIB1-MP. (B) Images of the 3 components co-expressed in U2OS cells chemically fixed after 5 sec of light exposure. Puncta enriched in all 3 components are present on the dorsal surface and localize to the plasma membrane in a midplane slice. (C) (Top) Live U2OS cell imaged at 37°C before (left) and after a brief exposure to blue light. (Bottom) Insets from above showing domain coarsening over time. Images are frames from Supplementary Movie 7. (D) Curves representing the percentages of cells exhibiting Cry2-αGFP/CIB1-MP puncta in fields of cells chemically fixed after the varying exposure times to blue light. Cells either co-express PM-GFP or a soluble form of GFP. Representative fields for several light exposures are shown in Supplementary Figure S6. (E) Curves representing the percentage of cells with Cry2-αGFP/CIB1-MP puncta in cells treated and chemically fixed at different ambient temperatures (top) or in the presence of n-alcohols (bottom). (F) Curves representing the percentage of cells with Cry2-αGFP/CIB1-MP puncta in cells treated and chemically fixed after Chol modulation with MβCD or MβCD-Chol (left) or in the presence of the calcium ionophore <t>A23187</t> (right). Analogous curves for cells expressing soluble GFP are in Supplementary Figure S8. Scale bars are 10 μm in main images and 2 μm in insets. Movies showing the perturbations of E,F in live cells are shown in Supplementary Movies
Ionophore A23187, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/Antibiotic+A23187%2C+98%25/bio_rxiv__2024__08__26__609758-141-18-25
Average 94 stars, based on 1 article reviews
ionophore a23187 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Thermo Fisher antibiotic a23187
In vitro characterization of CG LLPS. (A) Scheme used for purifying GFP and 6x-His-tagged CGA or CGB, respectively. Stable lines expressing CGB-GFP and CGA-GFP under a doxycycline-inducible promoter are treated with doxycycline and the calcium ionophore <t>A23187</t> to induce secretion of the respective proteins in serum-free medium, which is then used for purification using Ni-NTA affinity columns. (B) Plot of CGA generated using PONDR depicting disordered regions in the proteins. Almost 90% of CGA is disordered when analyzed using the VL-XT algorithm. (C) Coomassie-stained gel depicting purified CGA-GFP. Images showing different droplets of CGA-GFP at different protein concentrations at pH 6.1 in presence of 5% PEG 8000. Note that the size of the condensates decreases with decreasing protein concentration. (D) Representative images of solutions containing CGA-GFP buffered at either pH 6.1(left) or pH 7.3 (right). Droplet formation occurs at pH 6.1 and not at pH 7.3. Droplets of CGA-GFP were induced at 4 µM protein concentration in presence of 5% dextran. (E) Images obtained from plating a solution of CGB-GFP (2.5 µM final concentration) to monitor the presence or absence on liquid-like condensates either without or with 250 µM or 5 mM calcium. Note that droplet formation is induced only in the presence of 5 mM calcium. (F) Phase diagram obtained by varying calcium and CGB concentrations after plating solutions on imaging dishes and observing after 15–20 min. Red circles indicate conditions where no droplets were seen, and green circles indicate conditions which favored presence of CGB droplets. (G) Images obtained from plating a solution of CGA-GFP (2.5 µM final concentration) in presence of either 250 µM, 20 or 40 mM calcium to test for the presence or absence of droplet formation. No droplets are seen even at 40 mM which is the highest calcium concentration. (H) Representative images of CGB-GFP (2.5 µM) in presence of different concentrations of zinc. At high concentrations zinc induces formation of insoluble aggregates but at low concentration, it induces CGB-GFP droplets. Source data are available for this figure: .
Antibiotic A23187, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/ANTIBIOTIC+A23187+98/pmc09526250-356-32-36
Average 91 stars, based on 1 article reviews
antibiotic a23187 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

94
Thermo Fisher pre loop 328082 tgaaagcccatctgtggctt
In vitro characterization of CG LLPS. (A) Scheme used for purifying GFP and 6x-His-tagged CGA or CGB, respectively. Stable lines expressing CGB-GFP and CGA-GFP under a doxycycline-inducible promoter are treated with doxycycline and the calcium ionophore <t>A23187</t> to induce secretion of the respective proteins in serum-free medium, which is then used for purification using Ni-NTA affinity columns. (B) Plot of CGA generated using PONDR depicting disordered regions in the proteins. Almost 90% of CGA is disordered when analyzed using the VL-XT algorithm. (C) Coomassie-stained gel depicting purified CGA-GFP. Images showing different droplets of CGA-GFP at different protein concentrations at pH 6.1 in presence of 5% PEG 8000. Note that the size of the condensates decreases with decreasing protein concentration. (D) Representative images of solutions containing CGA-GFP buffered at either pH 6.1(left) or pH 7.3 (right). Droplet formation occurs at pH 6.1 and not at pH 7.3. Droplets of CGA-GFP were induced at 4 µM protein concentration in presence of 5% dextran. (E) Images obtained from plating a solution of CGB-GFP (2.5 µM final concentration) to monitor the presence or absence on liquid-like condensates either without or with 250 µM or 5 mM calcium. Note that droplet formation is induced only in the presence of 5 mM calcium. (F) Phase diagram obtained by varying calcium and CGB concentrations after plating solutions on imaging dishes and observing after 15–20 min. Red circles indicate conditions where no droplets were seen, and green circles indicate conditions which favored presence of CGB droplets. (G) Images obtained from plating a solution of CGA-GFP (2.5 µM final concentration) in presence of either 250 µM, 20 or 40 mM calcium to test for the presence or absence of droplet formation. No droplets are seen even at 40 mM which is the highest calcium concentration. (H) Representative images of CGB-GFP (2.5 µM) in presence of different concentrations of zinc. At high concentrations zinc induces formation of insoluble aggregates but at low concentration, it induces CGB-GFP droplets. Source data are available for this figure: .
Pre Loop 328082 Tgaaagcccatctgtggctt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/A23187+1MG+1MG/us08178506-1958-53-114
Average 94 stars, based on 1 article reviews
pre loop 328082 tgaaagcccatctgtggctt - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Biotium bromo a23187
In vitro characterization of CG LLPS. (A) Scheme used for purifying GFP and 6x-His-tagged CGA or CGB, respectively. Stable lines expressing CGB-GFP and CGA-GFP under a doxycycline-inducible promoter are treated with doxycycline and the calcium ionophore <t>A23187</t> to induce secretion of the respective proteins in serum-free medium, which is then used for purification using Ni-NTA affinity columns. (B) Plot of CGA generated using PONDR depicting disordered regions in the proteins. Almost 90% of CGA is disordered when analyzed using the VL-XT algorithm. (C) Coomassie-stained gel depicting purified CGA-GFP. Images showing different droplets of CGA-GFP at different protein concentrations at pH 6.1 in presence of 5% PEG 8000. Note that the size of the condensates decreases with decreasing protein concentration. (D) Representative images of solutions containing CGA-GFP buffered at either pH 6.1(left) or pH 7.3 (right). Droplet formation occurs at pH 6.1 and not at pH 7.3. Droplets of CGA-GFP were induced at 4 µM protein concentration in presence of 5% dextran. (E) Images obtained from plating a solution of CGB-GFP (2.5 µM final concentration) to monitor the presence or absence on liquid-like condensates either without or with 250 µM or 5 mM calcium. Note that droplet formation is induced only in the presence of 5 mM calcium. (F) Phase diagram obtained by varying calcium and CGB concentrations after plating solutions on imaging dishes and observing after 15–20 min. Red circles indicate conditions where no droplets were seen, and green circles indicate conditions which favored presence of CGB droplets. (G) Images obtained from plating a solution of CGA-GFP (2.5 µM final concentration) in presence of either 250 µM, 20 or 40 mM calcium to test for the presence or absence of droplet formation. No droplets are seen even at 40 mM which is the highest calcium concentration. (H) Representative images of CGB-GFP (2.5 µM) in presence of different concentrations of zinc. At high concentrations zinc induces formation of insoluble aggregates but at low concentration, it induces CGB-GFP droplets. Source data are available for this figure: .
Bromo A23187, supplied by Biotium, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/4-Bromo+A-23187%2C+free+acid/pm37513235-200-7-13
Average 91 stars, based on 1 article reviews
bromo a23187 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
FUJIFILM a23187
In vitro characterization of CG LLPS. (A) Scheme used for purifying GFP and 6x-His-tagged CGA or CGB, respectively. Stable lines expressing CGB-GFP and CGA-GFP under a doxycycline-inducible promoter are treated with doxycycline and the calcium ionophore <t>A23187</t> to induce secretion of the respective proteins in serum-free medium, which is then used for purification using Ni-NTA affinity columns. (B) Plot of CGA generated using PONDR depicting disordered regions in the proteins. Almost 90% of CGA is disordered when analyzed using the VL-XT algorithm. (C) Coomassie-stained gel depicting purified CGA-GFP. Images showing different droplets of CGA-GFP at different protein concentrations at pH 6.1 in presence of 5% PEG 8000. Note that the size of the condensates decreases with decreasing protein concentration. (D) Representative images of solutions containing CGA-GFP buffered at either pH 6.1(left) or pH 7.3 (right). Droplet formation occurs at pH 6.1 and not at pH 7.3. Droplets of CGA-GFP were induced at 4 µM protein concentration in presence of 5% dextran. (E) Images obtained from plating a solution of CGB-GFP (2.5 µM final concentration) to monitor the presence or absence on liquid-like condensates either without or with 250 µM or 5 mM calcium. Note that droplet formation is induced only in the presence of 5 mM calcium. (F) Phase diagram obtained by varying calcium and CGB concentrations after plating solutions on imaging dishes and observing after 15–20 min. Red circles indicate conditions where no droplets were seen, and green circles indicate conditions which favored presence of CGB droplets. (G) Images obtained from plating a solution of CGA-GFP (2.5 µM final concentration) in presence of either 250 µM, 20 or 40 mM calcium to test for the presence or absence of droplet formation. No droplets are seen even at 40 mM which is the highest calcium concentration. (H) Representative images of CGB-GFP (2.5 µM) in presence of different concentrations of zinc. At high concentrations zinc induces formation of insoluble aggregates but at low concentration, it induces CGB-GFP droplets. Source data are available for this figure: .
A23187, supplied by FUJIFILM, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a23187/a23187/pmc04520155-263-13-15
Average 90 stars, based on 1 article reviews
a23187 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Size distribution of washed platelets from healthy adult volunteers (A) treated with Ca2+ (1 mM) and A23187 (B) treated with Ca2+ (1 mM) and DMSO (vehicle).

Journal: Cureus

Article Title: An Investigation of Size Distribution and Calcium Signaling in Human Platelets

doi: 10.7759/cureus.59547

Figure Lengend Snippet: Size distribution of washed platelets from healthy adult volunteers (A) treated with Ca2+ (1 mM) and A23187 (B) treated with Ca2+ (1 mM) and DMSO (vehicle).

Article Snippet: As cytosolic Ca 2+ is an important component of cell signaling, we next checked the effect of ionophore A23187 on intracellular Ca 2+ concentration, [Ca 2+ ]i. A23187 (1 µM) and thrombin (1 U) (control) were added to Fura-2 loaded platelets in separate experimental sets in the presence of Ca 2+ (1 mM).

Techniques:

Washed platelets from healthy adult volunteers treated with Ca2+ (1 mM) and A23187 (red curve) compared to washed platelets treated with Ca2+ (1 mM) and vehicle DMSO (blue curve).

Journal: Cureus

Article Title: An Investigation of Size Distribution and Calcium Signaling in Human Platelets

doi: 10.7759/cureus.59547

Figure Lengend Snippet: Washed platelets from healthy adult volunteers treated with Ca2+ (1 mM) and A23187 (red curve) compared to washed platelets treated with Ca2+ (1 mM) and vehicle DMSO (blue curve).

Article Snippet: As cytosolic Ca 2+ is an important component of cell signaling, we next checked the effect of ionophore A23187 on intracellular Ca 2+ concentration, [Ca 2+ ]i. A23187 (1 µM) and thrombin (1 U) (control) were added to Fura-2 loaded platelets in separate experimental sets in the presence of Ca 2+ (1 mM).

Techniques:

Washed platelets from healthy adult volunteers treated with A23187 in the presence (green curve) and absence (red curve) of Ca2+ (1 mM).

Journal: Cureus

Article Title: An Investigation of Size Distribution and Calcium Signaling in Human Platelets

doi: 10.7759/cureus.59547

Figure Lengend Snippet: Washed platelets from healthy adult volunteers treated with A23187 in the presence (green curve) and absence (red curve) of Ca2+ (1 mM).

Article Snippet: As cytosolic Ca 2+ is an important component of cell signaling, we next checked the effect of ionophore A23187 on intracellular Ca 2+ concentration, [Ca 2+ ]i. A23187 (1 µM) and thrombin (1 U) (control) were added to Fura-2 loaded platelets in separate experimental sets in the presence of Ca 2+ (1 mM).

Techniques:

(A) A23187-induced rise in intracellular Ca 2+ in platelets. A23187 (1 µM) was added to Fura-2-loaded platelets in the presence of Ca 2+ (1 mM). (B) Thrombin-induced rise in intracellular Ca 2+ in platelets. Thrombin (1 U) was added to Fura-2-loaded platelets in the presence of Ca 2+ (1 mM).

Journal: Cureus

Article Title: An Investigation of Size Distribution and Calcium Signaling in Human Platelets

doi: 10.7759/cureus.59547

Figure Lengend Snippet: (A) A23187-induced rise in intracellular Ca 2+ in platelets. A23187 (1 µM) was added to Fura-2-loaded platelets in the presence of Ca 2+ (1 mM). (B) Thrombin-induced rise in intracellular Ca 2+ in platelets. Thrombin (1 U) was added to Fura-2-loaded platelets in the presence of Ca 2+ (1 mM).

Article Snippet: As cytosolic Ca 2+ is an important component of cell signaling, we next checked the effect of ionophore A23187 on intracellular Ca 2+ concentration, [Ca 2+ ]i. A23187 (1 µM) and thrombin (1 U) (control) were added to Fura-2 loaded platelets in separate experimental sets in the presence of Ca 2+ (1 mM).

Techniques:

Western blotting showing the effect of ionophore A23187 on platelet membrane protein degradation.

Journal: Cureus

Article Title: An Investigation of Size Distribution and Calcium Signaling in Human Platelets

doi: 10.7759/cureus.59547

Figure Lengend Snippet: Western blotting showing the effect of ionophore A23187 on platelet membrane protein degradation.

Article Snippet: As cytosolic Ca 2+ is an important component of cell signaling, we next checked the effect of ionophore A23187 on intracellular Ca 2+ concentration, [Ca 2+ ]i. A23187 (1 µM) and thrombin (1 U) (control) were added to Fura-2 loaded platelets in separate experimental sets in the presence of Ca 2+ (1 mM).

Techniques: Western Blot, Membrane

FIG. 1. Hypothetical pathway of cal- pain activation in the Ca2-induced apoptotic mechanism. Ca2 enters the photoreceptor outer segment via the cGMP-gated channels and activates cal- pain, promoting the cleavage of the Bcl-2 family protein, bid, which targets the mi- tochondria. Cytochrome c release from the mitochondria into the cytosol is trig- gered by the preceding events, promoting the interaction of Apaf-1 and caspase-9 subsequently leading to caspase-3 activa- tion, which cleaves the DNA into high molecular weight fragments and results in morphological apoptosis. PARP, poly- (ADP)-ribose polymerase.

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 1. Hypothetical pathway of cal- pain activation in the Ca2-induced apoptotic mechanism. Ca2 enters the photoreceptor outer segment via the cGMP-gated channels and activates cal- pain, promoting the cleavage of the Bcl-2 family protein, bid, which targets the mi- tochondria. Cytochrome c release from the mitochondria into the cytosol is trig- gered by the preceding events, promoting the interaction of Apaf-1 and caspase-9 subsequently leading to caspase-3 activa- tion, which cleaves the DNA into high molecular weight fragments and results in morphological apoptosis. PARP, poly- (ADP)-ribose polymerase.

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Activation Assay, High Molecular Weight

FIG. 3. Measurement of intracellular Ca2 levels and cell viability in 661W cells. A, levels of intracellular Ca2 in 661W cells were measured by Fluo-3 dye using the FLIPR method. Cells were loaded with Fluo-3 dye, incubated for 1 h, and treated with 5 mol/liter A23187, 1 mmol/liter 8-Br-cGMP, or 1 mmol/liter IBMX. There was a significant increase in the levels of intracellular Ca2 in 661W cells after treatment with any of the three compounds compared with the untreated controls. B, A23187 treatment caused a loss of cell viability in a time- and dose-dependent manner as indicated by the spectrophotometric analysis of 661W cells after a 2-h incubation at 37 °C with 0.5 mg/ml MTT dye. Cell viability was decreased 40% (5.8) by 24 h and 60% (4.1) by 30 h after a 5 mol/liter ionophore treatment. C, a significant decrease in cell viability was also observed after treatment with 8-Br-cGMP or IBMX (57.7 2.3% and 66.7 4.8% after a 24-h treatment, respectively). D, the effect of SJA6017 and z-devd-fmk pretreatment on cell viability was measured at different time intervals. Pretreatment with 100 mol/liter SJA6017 completely attenuated the ionophore-induced cell death (92.2 3.4%), whereas 2 mol/liter z-devd-fmk offered only partial protection (72 5.8%). A similar increase in cell viability after 24 h was observed in the case of 8-Br-cGMP (88.8 4.5% and 72.3 3.4%) and IBMX (90.4 5.6% and 73 4.6%) with SJA6017 and z-devd-fmk pretreatments, respectively. The results are shown as a percentage of control values (arbitrarily set at 100%). All experiments were performed in triplicate; p 0.05, and data are presented as the mean S.E.

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 3. Measurement of intracellular Ca2 levels and cell viability in 661W cells. A, levels of intracellular Ca2 in 661W cells were measured by Fluo-3 dye using the FLIPR method. Cells were loaded with Fluo-3 dye, incubated for 1 h, and treated with 5 mol/liter A23187, 1 mmol/liter 8-Br-cGMP, or 1 mmol/liter IBMX. There was a significant increase in the levels of intracellular Ca2 in 661W cells after treatment with any of the three compounds compared with the untreated controls. B, A23187 treatment caused a loss of cell viability in a time- and dose-dependent manner as indicated by the spectrophotometric analysis of 661W cells after a 2-h incubation at 37 °C with 0.5 mg/ml MTT dye. Cell viability was decreased 40% (5.8) by 24 h and 60% (4.1) by 30 h after a 5 mol/liter ionophore treatment. C, a significant decrease in cell viability was also observed after treatment with 8-Br-cGMP or IBMX (57.7 2.3% and 66.7 4.8% after a 24-h treatment, respectively). D, the effect of SJA6017 and z-devd-fmk pretreatment on cell viability was measured at different time intervals. Pretreatment with 100 mol/liter SJA6017 completely attenuated the ionophore-induced cell death (92.2 3.4%), whereas 2 mol/liter z-devd-fmk offered only partial protection (72 5.8%). A similar increase in cell viability after 24 h was observed in the case of 8-Br-cGMP (88.8 4.5% and 72.3 3.4%) and IBMX (90.4 5.6% and 73 4.6%) with SJA6017 and z-devd-fmk pretreatments, respectively. The results are shown as a percentage of control values (arbitrarily set at 100%). All experiments were performed in triplicate; p 0.05, and data are presented as the mean S.E.

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Incubation, Control

FIG. 4. Ionophore-induced apoptosis in 661W cells as measured by flow cytometry analysis. 661W cells were treated with A23187 alone and after pretreatment with SJA6017 or z-devd-fmk for 18 and 24 h. Cells were subjected to flow cytometry analysis after being stained with annexin V-fluorescein (y axis) and propidium iodide dyes (x axis) following the basic culture protocol. The population of cells undergoing apoptosis is localized in R2 and R4, representing the annexin-positive cells for phosphatidylserine externalization, whereas the viable population of cells is observed in R1. The untreated, viable cells (A and B) were present predominantly in R1. Cells treated with the A23187 ionophore for 18 h (C) showed a shift of 25 2.4% cells toward R4, indicating the uptake of annexin V and signifying apoptosis. The shift was enhanced further by a 24-h treatment with ionophore (D), at which time 40 4.6% of the cells were annexin-positive. Pretreatment with SJA6017 offered complete protection from the ionophore-induced apoptosis with only 6.8 1.8% (E) and 8 2.2% (F) annexin-positive cells, whereas z-devd-fmk offered only partial protection with 17.7 2.3% (G) and 24 4% (H) cells undergoing apoptosis. FITC, fluorescein isothiocyanate.

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 4. Ionophore-induced apoptosis in 661W cells as measured by flow cytometry analysis. 661W cells were treated with A23187 alone and after pretreatment with SJA6017 or z-devd-fmk for 18 and 24 h. Cells were subjected to flow cytometry analysis after being stained with annexin V-fluorescein (y axis) and propidium iodide dyes (x axis) following the basic culture protocol. The population of cells undergoing apoptosis is localized in R2 and R4, representing the annexin-positive cells for phosphatidylserine externalization, whereas the viable population of cells is observed in R1. The untreated, viable cells (A and B) were present predominantly in R1. Cells treated with the A23187 ionophore for 18 h (C) showed a shift of 25 2.4% cells toward R4, indicating the uptake of annexin V and signifying apoptosis. The shift was enhanced further by a 24-h treatment with ionophore (D), at which time 40 4.6% of the cells were annexin-positive. Pretreatment with SJA6017 offered complete protection from the ionophore-induced apoptosis with only 6.8 1.8% (E) and 8 2.2% (F) annexin-positive cells, whereas z-devd-fmk offered only partial protection with 17.7 2.3% (G) and 24 4% (H) cells undergoing apoptosis. FITC, fluorescein isothiocyanate.

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Flow Cytometry, Staining

FIG. 5. Ca2-induced caspase-3 and calpain activation in 661W cells. A, activation of calpain was induced in 661W cells after A23187, 8-Br-cGMP, or IBMX treatments, as determined by the use of membrane-permeant fluorogenic calpain-specific substrate Ac-LLY-AFC. The fluorescence (400/505 nm; excitation/emission) was measured as relative fluorescence units (RFU)/mg of protein and is expressed as arbitrary units determining the change in calpain activity, compared with untreated cells. Preincubation with SJA6017 completely inhibited the Ca2-induced calpain activity, whereas z-devd-fmk had no effect on calpain activity (p 0.02). B, caspase-8 activity was measured by assessing the fluorometric cleavage of IETD-AFC after treatment with A23187, which demonstrated no significant change in 661W cells. For all experiments, the arbitrary values represent the mean S.E. for triplicate experiments per treatment condition (p 0.01). C, the induction of caspase-3 activity in 661W cells after treatment with A23187, 8-Br-cGMP, or IBMX was measured by cleavage of the fluorogenic substrate DEVD-AFC (relative fluorescence units/mg of protein and expressed as arbitrary units). Preincubation with either z-devd-fmk or SJA6017 completely blocked the Ca2-induced caspase-3 activity (p 0.01). D, the ionophore induction of caspase-9 activity was measured by the cleavage of LEHD-AFC substrate. SJA6017 pretreatment completely attenuated the ionophore-induced caspase-9 activity, whereas z-devd-fmk offered no change (n 3, p 0.01).

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 5. Ca2-induced caspase-3 and calpain activation in 661W cells. A, activation of calpain was induced in 661W cells after A23187, 8-Br-cGMP, or IBMX treatments, as determined by the use of membrane-permeant fluorogenic calpain-specific substrate Ac-LLY-AFC. The fluorescence (400/505 nm; excitation/emission) was measured as relative fluorescence units (RFU)/mg of protein and is expressed as arbitrary units determining the change in calpain activity, compared with untreated cells. Preincubation with SJA6017 completely inhibited the Ca2-induced calpain activity, whereas z-devd-fmk had no effect on calpain activity (p 0.02). B, caspase-8 activity was measured by assessing the fluorometric cleavage of IETD-AFC after treatment with A23187, which demonstrated no significant change in 661W cells. For all experiments, the arbitrary values represent the mean S.E. for triplicate experiments per treatment condition (p 0.01). C, the induction of caspase-3 activity in 661W cells after treatment with A23187, 8-Br-cGMP, or IBMX was measured by cleavage of the fluorogenic substrate DEVD-AFC (relative fluorescence units/mg of protein and expressed as arbitrary units). Preincubation with either z-devd-fmk or SJA6017 completely blocked the Ca2-induced caspase-3 activity (p 0.01). D, the ionophore induction of caspase-9 activity was measured by the cleavage of LEHD-AFC substrate. SJA6017 pretreatment completely attenuated the ionophore-induced caspase-9 activity, whereas z-devd-fmk offered no change (n 3, p 0.01).

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Activation Assay, Membrane, Fluorescence, Activity Assay

FIG. 7. Ionophore-induced calpain cleavage of the proapo- ptotic Bcl-2 member protein bid. Truncated bid (15-kDa subunit) induced by A23187 treatment for 3 h was observed by Western blot analysis on a 12% SDS gel using a specific rabbit anti t-bid primary antibody. Bid cleavage could be blocked by pretreatment with calpain inhibitor, SJA6017, but not by z-devd-fmk. Lane 1, untreated control; lane 2, A23187 SJA6017; lane 3, A23187 z-devd-fmk; lane 4, A23187.

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 7. Ionophore-induced calpain cleavage of the proapo- ptotic Bcl-2 member protein bid. Truncated bid (15-kDa subunit) induced by A23187 treatment for 3 h was observed by Western blot analysis on a 12% SDS gel using a specific rabbit anti t-bid primary antibody. Bid cleavage could be blocked by pretreatment with calpain inhibitor, SJA6017, but not by z-devd-fmk. Lane 1, untreated control; lane 2, A23187 SJA6017; lane 3, A23187 z-devd-fmk; lane 4, A23187.

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Western Blot, SDS-Gel, Control

FIG. 6. Immunofluorescence analysis of ionophore-induced apoptotic components in 661W cells. Fluorescence microscopy was used to analyze the effect of ionophore on components of the apoptosis cascade (i.e. the presence of activated caspase-3, expression of calpain, bid cleavage, and cytochrome c release) in 661W cells. Cells were treated with A23187 for appropriate time periods, fixed in paraformaldehyde on chamber slides, incubated with antigen-specific polyclonal antibodies followed by fluorescein isothiocyanate-conjugated secondary antibodies, and observed under a fluorescence microscope. The untreated cells showed a very weak fluorescent signal for calpain (A) compared with the cells treated with the ionophore for 1 h. SJA6017 blocked the increase in calpain, whereas z-devd-fmk failed to do so. The antibody specific for truncated bid (B) revealed a significant increase in the intensity of fluorescence in the cells treated with ionophore for 3 h compared with the untreated cells. This increase in t-bid was attenuated by SJA6017 pretreatment, but not by z-devd-fmk. Cytochrome c (C) was localized to mitochondria in the untreated cells (punctate staining) but was found to be distributed throughout the cytosol (diffuse fluorescence in the cells) when treated with the ionophore for 4 h. SJA6017 prevented the cytochrome c translocation, whereas z-devd-fmk could not prevent this event. Caspase-3 activation (D) was induced by ionophore treatment for 6 h and was attenuated by both SJA6017 and z-devd-fmk pretreatments.

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 6. Immunofluorescence analysis of ionophore-induced apoptotic components in 661W cells. Fluorescence microscopy was used to analyze the effect of ionophore on components of the apoptosis cascade (i.e. the presence of activated caspase-3, expression of calpain, bid cleavage, and cytochrome c release) in 661W cells. Cells were treated with A23187 for appropriate time periods, fixed in paraformaldehyde on chamber slides, incubated with antigen-specific polyclonal antibodies followed by fluorescein isothiocyanate-conjugated secondary antibodies, and observed under a fluorescence microscope. The untreated cells showed a very weak fluorescent signal for calpain (A) compared with the cells treated with the ionophore for 1 h. SJA6017 blocked the increase in calpain, whereas z-devd-fmk failed to do so. The antibody specific for truncated bid (B) revealed a significant increase in the intensity of fluorescence in the cells treated with ionophore for 3 h compared with the untreated cells. This increase in t-bid was attenuated by SJA6017 pretreatment, but not by z-devd-fmk. Cytochrome c (C) was localized to mitochondria in the untreated cells (punctate staining) but was found to be distributed throughout the cytosol (diffuse fluorescence in the cells) when treated with the ionophore for 4 h. SJA6017 prevented the cytochrome c translocation, whereas z-devd-fmk could not prevent this event. Caspase-3 activation (D) was induced by ionophore treatment for 6 h and was attenuated by both SJA6017 and z-devd-fmk pretreatments.

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Immunofluorescence, Fluorescence, Microscopy, Expressing, Incubation, Staining, Translocation Assay, Activation Assay

FIG. 8. Ionophore-induced m. JC1 dye-stained 661W cells were analyzed with confocal microscopy in the absence (control) and presence of A23187. The untreated cells showed a significant population of cells with the J aggregate (red) form of the JC1 dye (A) compared with the J monomer (green) form (B) indicative of a normal mitochondrial mem- brane potential. A significant shift of J aggregate (red) to J monomer (green) was observed in the population of cells treated with A23187 for 6 h (C and D) signifying a loss of mitochondrial membrane potential. However, pretreatment with SJA6017 (E and F) or 10 mol/liter cyclos- porin A (CsA) a PTP antagonist (I and J), attenuated the mitochondrial depolarization induced by the ionophore; whereas no change in the J monomer (green) staining was observed after pretreatment with z-devd- fmk (G and H).

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 8. Ionophore-induced m. JC1 dye-stained 661W cells were analyzed with confocal microscopy in the absence (control) and presence of A23187. The untreated cells showed a significant population of cells with the J aggregate (red) form of the JC1 dye (A) compared with the J monomer (green) form (B) indicative of a normal mitochondrial mem- brane potential. A significant shift of J aggregate (red) to J monomer (green) was observed in the population of cells treated with A23187 for 6 h (C and D) signifying a loss of mitochondrial membrane potential. However, pretreatment with SJA6017 (E and F) or 10 mol/liter cyclos- porin A (CsA) a PTP antagonist (I and J), attenuated the mitochondrial depolarization induced by the ionophore; whereas no change in the J monomer (green) staining was observed after pretreatment with z-devd- fmk (G and H).

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Staining, Confocal Microscopy, Control, Membrane

FIG. 9. Determination of cytochrome c release. The release of cytochrome c was analyzed by quantitatively evaluating the mitochon- drial and cytoplasmic subcellular fractions and analyzing them fluoro- metrically. 661W cells were treated by A23187 for 4 h with and without 10 mol/liter cyclosporin A (CsA), SJA6017, or z-devd-fmk pretreat- ments. A23187 triggered the release of cytochrome c from the mitochon- dria into the cytosol as the cytochrome c concentration in the mitochon- drial subcellular fraction was decreased to 34 1.1% compared with the untreated control. SJA6017 pretreatment blocked the cytochrome c translocation with a considerable increase in the cytochrome c concen- tration of the mitochondrial fraction (93 1.3%). Pretreatment with z-devd-fmk did not block the release of cytochrome c in response to A23187 treatment as the mitochondrial cytochrome c concentration (30 1.4%) was comparable with the ionophore treatment alone. The PTP antagonist cyclosporin A was used as a positive control. All exper- iments were done in triplicate; p 0.01.

Journal: Journal of Biological Chemistry

Article Title: Calcium-induced Calpain Mediates Apoptosis via Caspase-3 in a Mouse Photoreceptor Cell Line

doi: 10.1074/jbc.m401037200

Figure Lengend Snippet: FIG. 9. Determination of cytochrome c release. The release of cytochrome c was analyzed by quantitatively evaluating the mitochon- drial and cytoplasmic subcellular fractions and analyzing them fluoro- metrically. 661W cells were treated by A23187 for 4 h with and without 10 mol/liter cyclosporin A (CsA), SJA6017, or z-devd-fmk pretreat- ments. A23187 triggered the release of cytochrome c from the mitochon- dria into the cytosol as the cytochrome c concentration in the mitochon- drial subcellular fraction was decreased to 34 1.1% compared with the untreated control. SJA6017 pretreatment blocked the cytochrome c translocation with a considerable increase in the cytochrome c concen- tration of the mitochondrial fraction (93 1.3%). Pretreatment with z-devd-fmk did not block the release of cytochrome c in response to A23187 treatment as the mitochondrial cytochrome c concentration (30 1.4%) was comparable with the ionophore treatment alone. The PTP antagonist cyclosporin A was used as a positive control. All exper- iments were done in triplicate; p 0.01.

Article Snippet: Cell treatments were performed with the following compounds: Ca2 ionophore A23187 (Molecular Probes), cGMP-gated channel agonist, 8-Br-cGMP (Sigma), phosphodiesterase inhibitor IBMX (Sigma), calpain inhibitor SJA6017 (Senju Pharmaceuticals, Kobe, Japan), caspase-3 inhibitor z-devd-fmk (Alexis Biochemicals), caspase-8 inhibitor z-ietd-fmk (Calbiochem) caspase-9 inhibitor z-lehd-fmk (Calbiochem), and cyclosporin A (Sigma).

Techniques: Concentration Assay, Control, Translocation Assay, Blocking Assay, Positive Control

Figure 4. Menopause does not change structural properties of cerebral parenchymal arterioles. Summary graphs show- ing that outer diameter (A), lumen diameter (B), wall thick- ness (C), and wall-to-lumen ratio (D) in parenchymal arterioles were unchanged by menopause. Data are means ± SE; N = 8 to 8 arterioles from 8 mice/group, ana- lyzed by 2-way ANOVA with a Bonferroni post hoc correction for multiple comparisons. Passive structural measurements were obtained in pressurized arterioles incubated in Ca2þ- free conditions with addition of vasodilators to the superfus- ing bath.

Journal: American journal of physiology. Heart and circulatory physiology

Article Title: Cerebral arteriolar and neurovascular dysfunction after chemically induced menopause in mice.

doi: 10.1152/ajpheart.00276.2022

Figure Lengend Snippet: Figure 4. Menopause does not change structural properties of cerebral parenchymal arterioles. Summary graphs show- ing that outer diameter (A), lumen diameter (B), wall thick- ness (C), and wall-to-lumen ratio (D) in parenchymal arterioles were unchanged by menopause. Data are means ± SE; N = 8 to 8 arterioles from 8 mice/group, ana- lyzed by 2-way ANOVA with a Bonferroni post hoc correction for multiple comparisons. Passive structural measurements were obtained in pressurized arterioles incubated in Ca2þ- free conditions with addition of vasodilators to the superfus- ing bath.

Article Snippet: Similarly, dilation to the Ca2þ ionophore A23187 (1 mM; Tocris Bioscience, Bristol, UK, catalog no. 1234) ± L-NAME was evaluated.

Techniques: Incubation

Figure 5. Biomechanical properties of cerebral parenchymal arterioles remain unchanged after menopause. A: summary graph showing that distensibil- ity, measured as % increase in diameter from a low-pressure baseline (5 mmHg), is unchanged by menopause. B: microvascular compliance, assessed by stress-strain relationships of parenchymal arterioles, is unaffected by menopause. Data are means ± SE; N = 8 arterioles from 8 mice/group, analyzed by 2-way ANOVA with a Bonferroni post hoc correction for multiple comparisons. C: summary bar graph demonstrating that the b-coefficient, calculated as the slope of the individual stress-strain curves, is not altered by menopause. Data are means ± SE; N = 7 arterioles from 7 mice/group, analyzed by 2-tailed Student’s t test. Passive biomechanical measurements were obtained in pressurized arterioles incubated in Ca2 þ-free conditions with addition of vasodilators to the superfusing bath.

Journal: American journal of physiology. Heart and circulatory physiology

Article Title: Cerebral arteriolar and neurovascular dysfunction after chemically induced menopause in mice.

doi: 10.1152/ajpheart.00276.2022

Figure Lengend Snippet: Figure 5. Biomechanical properties of cerebral parenchymal arterioles remain unchanged after menopause. A: summary graph showing that distensibil- ity, measured as % increase in diameter from a low-pressure baseline (5 mmHg), is unchanged by menopause. B: microvascular compliance, assessed by stress-strain relationships of parenchymal arterioles, is unaffected by menopause. Data are means ± SE; N = 8 arterioles from 8 mice/group, analyzed by 2-way ANOVA with a Bonferroni post hoc correction for multiple comparisons. C: summary bar graph demonstrating that the b-coefficient, calculated as the slope of the individual stress-strain curves, is not altered by menopause. Data are means ± SE; N = 7 arterioles from 7 mice/group, analyzed by 2-tailed Student’s t test. Passive biomechanical measurements were obtained in pressurized arterioles incubated in Ca2 þ-free conditions with addition of vasodilators to the superfusing bath.

Article Snippet: Similarly, dilation to the Ca2þ ionophore A23187 (1 mM; Tocris Bioscience, Bristol, UK, catalog no. 1234) ± L-NAME was evaluated.

Techniques: Incubation

(A) Schematic representation of the optogenetic system containing multivalent C1B1-MP, Cry2-αGFP, and a membrane anchored PM-GFP. Upon exposure to blue light, Cry2-αGFP can interact with itself and/or CIB1-MP. (B) Images of the 3 components co-expressed in U2OS cells chemically fixed after 5 sec of light exposure. Puncta enriched in all 3 components are present on the dorsal surface and localize to the plasma membrane in a midplane slice. (C) (Top) Live U2OS cell imaged at 37°C before (left) and after a brief exposure to blue light. (Bottom) Insets from above showing domain coarsening over time. Images are frames from Supplementary Movie 7. (D) Curves representing the percentages of cells exhibiting Cry2-αGFP/CIB1-MP puncta in fields of cells chemically fixed after the varying exposure times to blue light. Cells either co-express PM-GFP or a soluble form of GFP. Representative fields for several light exposures are shown in Supplementary Figure S6. (E) Curves representing the percentage of cells with Cry2-αGFP/CIB1-MP puncta in cells treated and chemically fixed at different ambient temperatures (top) or in the presence of n-alcohols (bottom). (F) Curves representing the percentage of cells with Cry2-αGFP/CIB1-MP puncta in cells treated and chemically fixed after Chol modulation with MβCD or MβCD-Chol (left) or in the presence of the calcium ionophore A23187 (right). Analogous curves for cells expressing soluble GFP are in Supplementary Figure S8. Scale bars are 10 μm in main images and 2 μm in insets. Movies showing the perturbations of E,F in live cells are shown in Supplementary Movies

Journal: bioRxiv

Article Title: Prewetting couples membrane and protein phase transitions to greatly enhance coexistence in models and cells

doi: 10.1101/2024.08.26.609758

Figure Lengend Snippet: (A) Schematic representation of the optogenetic system containing multivalent C1B1-MP, Cry2-αGFP, and a membrane anchored PM-GFP. Upon exposure to blue light, Cry2-αGFP can interact with itself and/or CIB1-MP. (B) Images of the 3 components co-expressed in U2OS cells chemically fixed after 5 sec of light exposure. Puncta enriched in all 3 components are present on the dorsal surface and localize to the plasma membrane in a midplane slice. (C) (Top) Live U2OS cell imaged at 37°C before (left) and after a brief exposure to blue light. (Bottom) Insets from above showing domain coarsening over time. Images are frames from Supplementary Movie 7. (D) Curves representing the percentages of cells exhibiting Cry2-αGFP/CIB1-MP puncta in fields of cells chemically fixed after the varying exposure times to blue light. Cells either co-express PM-GFP or a soluble form of GFP. Representative fields for several light exposures are shown in Supplementary Figure S6. (E) Curves representing the percentage of cells with Cry2-αGFP/CIB1-MP puncta in cells treated and chemically fixed at different ambient temperatures (top) or in the presence of n-alcohols (bottom). (F) Curves representing the percentage of cells with Cry2-αGFP/CIB1-MP puncta in cells treated and chemically fixed after Chol modulation with MβCD or MβCD-Chol (left) or in the presence of the calcium ionophore A23187 (right). Analogous curves for cells expressing soluble GFP are in Supplementary Figure S8. Scale bars are 10 μm in main images and 2 μm in insets. Movies showing the perturbations of E,F in live cells are shown in Supplementary Movies

Article Snippet: Fluorescent lipid analog 3,3’-Dioctadecyloxacarbocyanine Perchlorate (DiO-C18) (Cat#: D3898), Alexa Fluor 532 NHS Ester (Succinimidyl Ester) (Cat# A20101MP) and Ionophore A23187 (Cat# J63020.MA) were purchased from Thermo Fisher Scientific (Waltham, MA, USA).

Techniques: Membrane, Clinical Proteomics, Expressing

In vitro characterization of CG LLPS. (A) Scheme used for purifying GFP and 6x-His-tagged CGA or CGB, respectively. Stable lines expressing CGB-GFP and CGA-GFP under a doxycycline-inducible promoter are treated with doxycycline and the calcium ionophore A23187 to induce secretion of the respective proteins in serum-free medium, which is then used for purification using Ni-NTA affinity columns. (B) Plot of CGA generated using PONDR depicting disordered regions in the proteins. Almost 90% of CGA is disordered when analyzed using the VL-XT algorithm. (C) Coomassie-stained gel depicting purified CGA-GFP. Images showing different droplets of CGA-GFP at different protein concentrations at pH 6.1 in presence of 5% PEG 8000. Note that the size of the condensates decreases with decreasing protein concentration. (D) Representative images of solutions containing CGA-GFP buffered at either pH 6.1(left) or pH 7.3 (right). Droplet formation occurs at pH 6.1 and not at pH 7.3. Droplets of CGA-GFP were induced at 4 µM protein concentration in presence of 5% dextran. (E) Images obtained from plating a solution of CGB-GFP (2.5 µM final concentration) to monitor the presence or absence on liquid-like condensates either without or with 250 µM or 5 mM calcium. Note that droplet formation is induced only in the presence of 5 mM calcium. (F) Phase diagram obtained by varying calcium and CGB concentrations after plating solutions on imaging dishes and observing after 15–20 min. Red circles indicate conditions where no droplets were seen, and green circles indicate conditions which favored presence of CGB droplets. (G) Images obtained from plating a solution of CGA-GFP (2.5 µM final concentration) in presence of either 250 µM, 20 or 40 mM calcium to test for the presence or absence of droplet formation. No droplets are seen even at 40 mM which is the highest calcium concentration. (H) Representative images of CGB-GFP (2.5 µM) in presence of different concentrations of zinc. At high concentrations zinc induces formation of insoluble aggregates but at low concentration, it induces CGB-GFP droplets. Source data are available for this figure: .

Journal: The Journal of Cell Biology

Article Title: Liquid–liquid phase separation facilitates the biogenesis of secretory storage granules

doi: 10.1083/jcb.202206132

Figure Lengend Snippet: In vitro characterization of CG LLPS. (A) Scheme used for purifying GFP and 6x-His-tagged CGA or CGB, respectively. Stable lines expressing CGB-GFP and CGA-GFP under a doxycycline-inducible promoter are treated with doxycycline and the calcium ionophore A23187 to induce secretion of the respective proteins in serum-free medium, which is then used for purification using Ni-NTA affinity columns. (B) Plot of CGA generated using PONDR depicting disordered regions in the proteins. Almost 90% of CGA is disordered when analyzed using the VL-XT algorithm. (C) Coomassie-stained gel depicting purified CGA-GFP. Images showing different droplets of CGA-GFP at different protein concentrations at pH 6.1 in presence of 5% PEG 8000. Note that the size of the condensates decreases with decreasing protein concentration. (D) Representative images of solutions containing CGA-GFP buffered at either pH 6.1(left) or pH 7.3 (right). Droplet formation occurs at pH 6.1 and not at pH 7.3. Droplets of CGA-GFP were induced at 4 µM protein concentration in presence of 5% dextran. (E) Images obtained from plating a solution of CGB-GFP (2.5 µM final concentration) to monitor the presence or absence on liquid-like condensates either without or with 250 µM or 5 mM calcium. Note that droplet formation is induced only in the presence of 5 mM calcium. (F) Phase diagram obtained by varying calcium and CGB concentrations after plating solutions on imaging dishes and observing after 15–20 min. Red circles indicate conditions where no droplets were seen, and green circles indicate conditions which favored presence of CGB droplets. (G) Images obtained from plating a solution of CGA-GFP (2.5 µM final concentration) in presence of either 250 µM, 20 or 40 mM calcium to test for the presence or absence of droplet formation. No droplets are seen even at 40 mM which is the highest calcium concentration. (H) Representative images of CGB-GFP (2.5 µM) in presence of different concentrations of zinc. At high concentrations zinc induces formation of insoluble aggregates but at low concentration, it induces CGB-GFP droplets. Source data are available for this figure: .

Article Snippet: Fully confluent cells were induced for protein expression by the addition of doxycycline monohydrate (1 μg/ml; LKT Laboratories) in serum-free DMEM high glucose also containing proteinase inhibitor aprotinin (1 μg/ml; Sigma-Aldrich) and antibiotic A23187 (1 μg/ml; Thermo Fisher Scientific Alfa Aesar) for 15–20 h. Medium was collected and pre-cleared of cells by centrifugation and then by filtration using a 0.45 μm filter.

Techniques: In Vitro, Expressing, Purification, Generated, Staining, Protein Concentration, Concentration Assay, Imaging