a Search Results


srp260243 experimental models  (Jackson Laboratory)
86
Jackson Laboratory srp260243 experimental models
Srp260243 Experimental Models, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+experimental+models+n+paper/pm37858468-303-90-96
Average 86 stars, based on 1 article reviews
srp260243 experimental models - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
technology n a mouse  (Jackson Laboratory)
86
Jackson Laboratory technology n a mouse
Technology N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+mouse+n+technology/pm40233748-231-56-61
Average 86 stars, based on 1 article reviews
technology n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer  (Sangon Biotech)
86
Sangon Biotech ctaatgggaacgtcacacacca sangon biotech n a tnfa primer
Ctaatgggaacgtcacacacca Sangon Biotech N A Tnfa Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+biotech+ctaatgggaacgtcacacacca+n+primer+sangon+tnfa/pm38159573-806-207-208
Average 86 stars, based on 1 article reviews
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer  (Sangon Biotech)
86
Sangon Biotech ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer
Ggcttctttcgcacaatctcaat Sangon Biotech N A Pdgfra Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+biotech+ggcttctttcgcacaatctcaat+n+pdgfra+primer+sangon/pm35863346-241-84-85
Average 86 stars, based on 1 article reviews
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
ivo spiegel n a mouse  (Jackson Laboratory)
86
Jackson Laboratory ivo spiegel n a mouse
Ivo Spiegel N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+ivo+mouse+n+spiegel/pmc06226614__mmc2-241-21-26
Average 86 stars, based on 1 article reviews
ivo spiegel n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer  (Sangon Biotech)
86
Sangon Biotech cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer
Cagggtcaaggcaagcctc Sangon Biotech N A Cxcl5 Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+biotech+cagggtcaaggcaagcctc+cxcl5+n+primer+sangon/pm38159573-806-235-236
Average 86 stars, based on 1 article reviews
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
accttccaggatgaggacatga sangon biotech n a il1b primer  (Sangon Biotech)
86
Sangon Biotech accttccaggatgaggacatga sangon biotech n a il1b primer
Accttccaggatgaggacatga Sangon Biotech N A Il1b Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+accttccaggatgaggacatga+biotech+il1b+n+primer+sangon/pm38159573-806-200-201
Average 86 stars, based on 1 article reviews
accttccaggatgaggacatga sangon biotech n a il1b primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
dr d schlessigner nia nih n a mouse  (Jackson Laboratory)
86
Jackson Laboratory dr d schlessigner nia nih n a mouse
KEY RESOURCES TABLE
Dr D Schlessigner Nia Nih N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+dr+j+leonard+mouse+n+nhlbi+nih+w/pmc06532063-849-82-90
Average 86 stars, based on 1 article reviews
dr d schlessigner nia nih n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
e crawford81 n a mouse  (Jackson Laboratory)
86
Jackson Laboratory e crawford81 n a mouse
KEY RESOURCES TABLE
E Crawford81 N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+crawford81+e+mouse+n/pm38280375-462-206-211
Average 86 stars, based on 1 article reviews
e crawford81 n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
adrb2 flox g karsenty n a mouse  (Jackson Laboratory)
86
Jackson Laboratory adrb2 flox g karsenty n a mouse
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Adrb2 Flox G Karsenty N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+adrb2+flox+g+karsenty+mouse+n/pmc07271821-861-65-73
Average 86 stars, based on 1 article reviews
adrb2 flox g karsenty n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
n a lenti trpc4 c6 shrna cmv egfp obio technology  (Obio Technology Corp Ltd)
86
Obio Technology Corp Ltd n a lenti trpc4 c6 shrna cmv egfp obio technology
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
N A Lenti Trpc4 C6 Shrna Cmv Egfp Obio Technology, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+c1+cmv+egfp+lenti+n+obio+shrna+technology+trpa1/pm36476978-252-109-111
Average 86 stars, based on 1 article reviews
n a lenti trpc4 c6 shrna cmv egfp obio technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
eurofins n a prom  (Eurofins)
86
Eurofins eurofins n a prom
(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of <t>Adrb2</t> transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Eurofins N A Prom, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a/a+eurofins+n+prom/pmc06791812__mmc2-529-167-167
Average 86 stars, based on 1 article reviews
eurofins n a prom - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: Homeostatic Control of Sebaceous Glands by Innate Lymphoid Cells Regulates Commensal Bacteria Equilibrium

doi: 10.1016/j.cell.2018.12.031

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Park (NCI/NIH) N/A Mouse: Tslp −/− Dr. S. Nakae (University of Tokyo) CDB0777K (RIKEN) Mouse: Il7 −/− Tslp −/− Dr. K. Moro (RIKEN) N/A Mouse: Tslpr −/− Dr. W. J. Leonard (NHLBI/NIH) N/A Mouse: B6.129S6- Ccr6 tm1(EGFP)Irw /J ( Ccr6 GFP/GFP ) Jackson Laboratory Stock No: 013061 Mouse: Tnf −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Lta −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Ltb −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Tnf −/− Lta − / − Ltb − / − Dr. D. Schlessigner (NIA/NIH) N/A Mouse: B6.FVB-Tg(Rorc-cre)1Litt/J (Rorc-Cre) Jackson Laboratory Stock No: 022791 Mouse: B6.129X1- Gt(ROSA)26Sor tm1(EYFP)Cos /J (ROSA-EYFP) Jackson Laboratory Stock No: 006148 Mouse: B6;SJL-Tg(Krt1–15-cre/PGR)22Cot/J Jackson Laboratory Stock No: 005249 Mouse: Adam10 tm1.1Khr (Adam10 flox ) Dr. K. Horiuchi (National Defense Medical College) N/A Software and Algorithms FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo Partek Flow Partek http://www.partek.com/partekflow Partek Genomics Suite Partek http://www.partek.com/pgs nSolver Analysis Software 4.0 NanoString Technologies https://www.nanostring.com/products/analysis-software/nsolver GraphPad Prism GraphPad Software https://www.graphpad.com/ Imaris Bitplane http://www.bitplane.com/ Seurat Satija Lab https://satijalab.org/seurat/ Open in a separate window KEY RESOURCES TABLE

Techniques: Purification, Virus, Isolation, Recombinant, Staining, Transfection, Electron Microscopy, dsDNA Assay, Software

(A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Staining, Quantitative Proteomics, Immunoprecipitation, Control, Infection

Data and Software Availability

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression