Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight

Journal: Journal of Biological Chemistry

Article Title: The Leukocyte Chemotactic Receptor FPR1 Is Functionally Expressed on Human Lens Epithelial Cells

doi: 10.1074/jbc.m112.411181

Figure Lengend Snippet: FIGURE 1. Lens epithelial cells constitutively express FPR1; RNA and immunophenotypic evidence. A, RNA is shown. FHL 124 cells nucleofected with the shRNA indicated on the x axis were analyzed for FPR1 mRNA expression by PCR. B, immunophenotype is shown. FHL 124 cells nucleofected with the shRNAs indicated on the x axis were analyzed by FACS with a PE-labeled anti-FPR1 mAb. C, ligand binding; FHL 124 cells nucleofected with the shRNAs indicated on the x axis were analyzed by FACS with the fluorescent agonist ligand fNLFNYK-Fl (10 nM). D, Ca2 assay; FHL 124 cells nucleofected with the shRNAs indicated in the legend were stimulated with 1 M fMLF, and the Ca2 response was followed for 150 s. The base line (first 20 s) of each individual curve and a background curve recorded with only buffer (no fMLF) were subtracted from each signal. Then all experiments were pooled and transformed to % of the peak signal intensity of the siRNA-free (only H2O) control. All data are the means S.E.

Article Snippet: 100 pmol of FPR1 siRNA (three 20–25-nucleotide siRNAs, catalog no. sc-40121, Santa Cruz Biotechnology, Santa Cruz, CA), 100 pmol of scrambled fluorescein-labeled siRNA (Santa Cruz Biotechnology, catalog no. sc-36869), or water was added to 100 l of cell suspension and nucleofected with program X-005 (FHL 124) or Q-001 (HEK 293-FPR1 ) of the Nucleofector II Device (Lonza).

Techniques: shRNA, Expressing, Labeling, Ligand Binding Assay, Transformation Assay, Control