|
Jackson Laboratory
srp260243 experimental models Srp260243 Experimental Models, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+experimental+models+n+paper/pm37858468-303-90-96 Average 86 stars, based on 1 article reviews
srp260243 experimental models - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
technology n a mouse Technology N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+mouse+n+technology/pm40233748-231-56-61 Average 86 stars, based on 1 article reviews
technology n a mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer Ctaatgggaacgtcacacacca Sangon Biotech N A Tnfa Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+biotech+ctaatgggaacgtcacacacca+n+primer+sangon+tnfa/pm38159573-806-207-208 Average 86 stars, based on 1 article reviews
ctaatgggaacgtcacacacca sangon biotech n a tnfa primer - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer Ggcttctttcgcacaatctcaat Sangon Biotech N A Pdgfra Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+biotech+ggcttctttcgcacaatctcaat+n+pdgfra+primer+sangon/pm35863346-241-84-85 Average 86 stars, based on 1 article reviews
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
ivo spiegel n a mouse Ivo Spiegel N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+ivo+mouse+n+spiegel/pmc06226614__mmc2-241-21-26 Average 86 stars, based on 1 article reviews
ivo spiegel n a mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer Cagggtcaaggcaagcctc Sangon Biotech N A Cxcl5 Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+biotech+cagggtcaaggcaagcctc+cxcl5+n+primer+sangon/pm38159573-806-235-236 Average 86 stars, based on 1 article reviews
cagggtcaaggcaagcctc sangon biotech n a cxcl5 primer - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
accttccaggatgaggacatga sangon biotech n a il1b primer Accttccaggatgaggacatga Sangon Biotech N A Il1b Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+accttccaggatgaggacatga+biotech+il1b+n+primer+sangon/pm38159573-806-200-201 Average 86 stars, based on 1 article reviews
accttccaggatgaggacatga sangon biotech n a il1b primer - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
dr d schlessigner nia nih n a mouse ![]() Dr D Schlessigner Nia Nih N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+dr+j+leonard+mouse+n+nhlbi+nih+w/pmc06532063-849-82-90 Average 86 stars, based on 1 article reviews
dr d schlessigner nia nih n a mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
e crawford81 n a mouse ![]() E Crawford81 N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+crawford81+e+mouse+n/pm38280375-462-206-211 Average 86 stars, based on 1 article reviews
e crawford81 n a mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
adrb2 flox g karsenty n a mouse ![]() Adrb2 Flox G Karsenty N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+adrb2+flox+g+karsenty+mouse+n/pmc07271821-861-65-73 Average 86 stars, based on 1 article reviews
adrb2 flox g karsenty n a mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
n a lenti trpc4 c6 shrna cmv egfp obio technology ![]() N A Lenti Trpc4 C6 Shrna Cmv Egfp Obio Technology, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+c1+cmv+egfp+lenti+n+obio+shrna+technology+trpa1/pm36476978-252-109-111 Average 86 stars, based on 1 article reviews
n a lenti trpc4 c6 shrna cmv egfp obio technology - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Eurofins
eurofins n a prom ![]() Eurofins N A Prom, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/a+eurofins+n+prom/pmc06791812__mmc2-529-167-167 Average 86 stars, based on 1 article reviews
eurofins n a prom - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Homeostatic Control of Sebaceous Glands by Innate Lymphoid Cells Regulates Commensal Bacteria Equilibrium
doi: 10.1016/j.cell.2018.12.031
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Park (NCI/NIH) N/A Mouse: Tslp −/− Dr. S. Nakae (University of Tokyo) CDB0777K (RIKEN) Mouse: Il7 −/− Tslp −/− Dr. K. Moro (RIKEN) N/A Mouse: Tslpr −/− Dr. W. J. Leonard (NHLBI/NIH) N/A Mouse: B6.129S6- Ccr6 tm1(EGFP)Irw /J ( Ccr6 GFP/GFP ) Jackson Laboratory Stock No: 013061 Mouse: Tnf −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Lta −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Ltb −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Tnf −/− Lta − / − Ltb − / −
Techniques: Purification, Virus, Isolation, Recombinant, Staining, Transfection, Electron Microscopy, dsDNA Assay, Software
Journal: Cell
Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss
doi: 10.1016/j.cell.2019.12.002
Figure Lengend Snippet: (A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.
Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse:
Techniques: Staining, Quantitative Proteomics, Immunoprecipitation, Control, Infection
Journal: Cell
Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss
doi: 10.1016/j.cell.2019.12.002
Figure Lengend Snippet: Data and Software Availability
Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse:
Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression