5gc Search Results


90
Fluka Chemical 4.5 gc
4.5 Gc, supplied by Fluka Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/4.5 gc/product/Fluka Chemical
Average 90 stars, based on 1 article reviews
4.5 gc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Metabion International AG issr primers (cag)5gc
Issr Primers (Cag)5gc, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/issr primers (cag)5gc/product/Metabion International AG
Average 90 stars, based on 1 article reviews
issr primers (cag)5gc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Varian Medical saturn 5 gc/ms
Saturn 5 Gc/Ms, supplied by Varian Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/saturn 5 gc/ms/product/Varian Medical
Average 90 stars, based on 1 article reviews
saturn 5 gc/ms - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fluka Chemical acetaldehyde puriss. p.a, anhydrous, assay ≥ 99.5% (gc)
Acetaldehyde Puriss. P.A, Anhydrous, Assay ≥ 99.5% (Gc), supplied by Fluka Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acetaldehyde puriss. p.a, anhydrous, assay ≥ 99.5% (gc)/product/Fluka Chemical
Average 90 stars, based on 1 article reviews
acetaldehyde puriss. p.a, anhydrous, assay ≥ 99.5% (gc) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fluka Chemical glycerol 99.5% gc
Glycerol 99.5% Gc, supplied by Fluka Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glycerol 99.5% gc/product/Fluka Chemical
Average 90 stars, based on 1 article reviews
glycerol 99.5% gc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
honeywell international acetonitril 99.5% (gc)
Acetonitril 99.5% (Gc), supplied by honeywell international, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acetonitril 99.5% (gc)/product/honeywell international
Average 90 stars, based on 1 article reviews
acetonitril 99.5% (gc) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Boehringer Mannheim 5 ll 5 · gc-rich pcr reaction buffer
5 Ll 5 · Gc Rich Pcr Reaction Buffer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5 ll 5 · gc-rich pcr reaction buffer/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
5 ll 5 · gc-rich pcr reaction buffer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
SRI Instruments multigas #5 gc
Multigas #5 Gc, supplied by SRI Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multigas #5 gc/product/SRI Instruments
Average 90 stars, based on 1 article reviews
multigas #5 gc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sangon Biotech hottip sirna (5'‑gc cgccguguccaccggcagcu‑3')
Hottip Sirna (5'‑Gc Cgccguguccaccggcagcu‑3'), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hottip sirna (5'‑gc cgccguguccaccggcagcu‑3')/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
hottip sirna (5'‑gc cgccguguccaccggcagcu‑3') - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sinopharm ltd methylbenzene (>99.5%, gc)
Methylbenzene (>99.5%, Gc), supplied by Sinopharm ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/methylbenzene (>99.5%, gc)/product/Sinopharm ltd
Average 90 stars, based on 1 article reviews
methylbenzene (>99.5%, gc) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Merck KGaA 10% dextrose solution d-(+)-glucose ≥99.5% (gc)
10% Dextrose Solution D (+) Glucose ≥99.5% (Gc), supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10% dextrose solution d-(+)-glucose ≥99.5% (gc)/product/Merck KGaA
Average 90 stars, based on 1 article reviews
10% dextrose solution d-(+)-glucose ≥99.5% (gc) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
NextGen Sciences 5gc
5gc, supplied by NextGen Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5gc/product/NextGen Sciences
Average 90 stars, based on 1 article reviews
5gc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results