90
|
Fluka Chemical
4.5 gc 4.5 Gc, supplied by Fluka Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/4.5 gc/product/Fluka Chemical Average 90 stars, based on 1 article reviews
4.5 gc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
issr primers (cag)5gc Issr Primers (Cag)5gc, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/issr primers (cag)5gc/product/Metabion International AG Average 90 stars, based on 1 article reviews
issr primers (cag)5gc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Varian Medical
saturn 5 gc/ms Saturn 5 Gc/Ms, supplied by Varian Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/saturn 5 gc/ms/product/Varian Medical Average 90 stars, based on 1 article reviews
saturn 5 gc/ms - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Fluka Chemical
acetaldehyde puriss. p.a, anhydrous, assay ≥ 99.5% (gc) Acetaldehyde Puriss. P.A, Anhydrous, Assay ≥ 99.5% (Gc), supplied by Fluka Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/acetaldehyde puriss. p.a, anhydrous, assay ≥ 99.5% (gc)/product/Fluka Chemical Average 90 stars, based on 1 article reviews
acetaldehyde puriss. p.a, anhydrous, assay ≥ 99.5% (gc) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Fluka Chemical
glycerol 99.5% gc Glycerol 99.5% Gc, supplied by Fluka Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/glycerol 99.5% gc/product/Fluka Chemical Average 90 stars, based on 1 article reviews
glycerol 99.5% gc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
honeywell international
acetonitril 99.5% (gc) Acetonitril 99.5% (Gc), supplied by honeywell international, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/acetonitril 99.5% (gc)/product/honeywell international Average 90 stars, based on 1 article reviews
acetonitril 99.5% (gc) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Boehringer Mannheim
5 ll 5 · gc-rich pcr reaction buffer 5 Ll 5 · Gc Rich Pcr Reaction Buffer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 ll 5 · gc-rich pcr reaction buffer/product/Boehringer Mannheim Average 90 stars, based on 1 article reviews
5 ll 5 · gc-rich pcr reaction buffer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
SRI Instruments
multigas #5 gc Multigas #5 Gc, supplied by SRI Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multigas #5 gc/product/SRI Instruments Average 90 stars, based on 1 article reviews
multigas #5 gc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
hottip sirna (5'‑gc cgccguguccaccggcagcu‑3') Hottip Sirna (5'‑Gc Cgccguguccaccggcagcu‑3'), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hottip sirna (5'‑gc cgccguguccaccggcagcu‑3')/product/Sangon Biotech Average 90 stars, based on 1 article reviews
hottip sirna (5'‑gc cgccguguccaccggcagcu‑3') - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Sinopharm ltd
methylbenzene (>99.5%, gc) Methylbenzene (>99.5%, Gc), supplied by Sinopharm ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/methylbenzene (>99.5%, gc)/product/Sinopharm ltd Average 90 stars, based on 1 article reviews
methylbenzene (>99.5%, gc) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Merck KGaA
10% dextrose solution d-(+)-glucose ≥99.5% (gc) 10% Dextrose Solution D (+) Glucose ≥99.5% (Gc), supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/10% dextrose solution d-(+)-glucose ≥99.5% (gc)/product/Merck KGaA Average 90 stars, based on 1 article reviews
10% dextrose solution d-(+)-glucose ≥99.5% (gc) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
NextGen Sciences
5gc 5gc, supplied by NextGen Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5gc/product/NextGen Sciences Average 90 stars, based on 1 article reviews
5gc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |