37-508 Search Results


93
Santa Cruz Biotechnology xiap sirna sixiap
a AGS (left) and MKN45 (right) cells treated with CBD for 24 h. Cells were collected for western blotting with the indicated antibodies. b AGS cells were treated with 4 μM of CBD for 24 h. Cells were immunostained with <t>anti-XIAP</t> (Red). Images were obtained using a confocal microscope. c , d AGS cells were transfected with myc-XIAP plasmid and treated with 4 μM CBD for 24 h. Apoptosis of cells was determined by flow cytometry ( c ) and immunoblotting ( d ). *** P < 0.001. e , f XIAP was knocked down using <t>siRNA,</t> treated with 4 μM CBD for 24 h, and subjected to flow cytometry ( e ) and west e rn blotting ( f )
Xiap Sirna Sixiap, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/37-508/pmc06838113-152-3-16?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
xiap sirna sixiap - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology xiap shrna vectors
(A) Representative IHC staining for <t>XIAP</t> and pXIAP proteins in the corpus and the antrum of uninfected mice and ones infected with WT H. pylori strain PMSS1 or its cagE– isogenic mutant for 8 weeks. Insets show magnified views, 40x. Scale bars: 50 μm. Histograms show IHC scores for expression of XIAP and pXIAP proteins (n = 8/group). (B) Western blot analysis of XIAP, pXIAP, and Siva1 proteins in gastric tissues collected from control uninfected mice and ones infected with WT H. pylori strain PMSS1 and its cagE– isogenic mutant for 8 weeks (3 mice/group). Graphs show the densitometric analysis. Western blot analysis of Siva1 protein is also shown in Figure 1B. Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001.
Xiap Shrna Vectors, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/37-508/pmc07190987-512-20-23?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
xiap shrna vectors - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
ATCC cgcggagtggagcagttggtagctcgtcgggctcataacccgaaggtcgtaggttcaagt cctgcctccgcaacca clostridium botulinum a atcc 19397 chr
(A) Representative IHC staining for <t>XIAP</t> and pXIAP proteins in the corpus and the antrum of uninfected mice and ones infected with WT H. pylori strain PMSS1 or its cagE– isogenic mutant for 8 weeks. Insets show magnified views, 40x. Scale bars: 50 μm. Histograms show IHC scores for expression of XIAP and pXIAP proteins (n = 8/group). (B) Western blot analysis of XIAP, pXIAP, and Siva1 proteins in gastric tissues collected from control uninfected mice and ones infected with WT H. pylori strain PMSS1 and its cagE– isogenic mutant for 8 weeks (3 mice/group). Graphs show the densitometric analysis. Western blot analysis of Siva1 protein is also shown in Figure 1B. Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001.
Cgcggagtggagcagttggtagctcgtcgggctcataacccgaaggtcgtaggttcaagt Cctgcctccgcaacca Clostridium Botulinum A Atcc 19397 Chr, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/37-508/pmc07285048__biology___09___00088___s001-6668-18-20?v=ATCC
Average 90 stars, based on 1 article reviews
cgcggagtggagcagttggtagctcgtcgggctcataacccgaaggtcgtaggttcaagt cctgcctccgcaacca clostridium botulinum a atcc 19397 chr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier

Image Search Results


a AGS (left) and MKN45 (right) cells treated with CBD for 24 h. Cells were collected for western blotting with the indicated antibodies. b AGS cells were treated with 4 μM of CBD for 24 h. Cells were immunostained with anti-XIAP (Red). Images were obtained using a confocal microscope. c , d AGS cells were transfected with myc-XIAP plasmid and treated with 4 μM CBD for 24 h. Apoptosis of cells was determined by flow cytometry ( c ) and immunoblotting ( d ). *** P < 0.001. e , f XIAP was knocked down using siRNA, treated with 4 μM CBD for 24 h, and subjected to flow cytometry ( e ) and west e rn blotting ( f )

Journal: Cell Death & Disease

Article Title: Cannabidiol promotes apoptosis via regulation of XIAP/Smac in gastric cancer

doi: 10.1038/s41419-019-2001-7

Figure Lengend Snippet: a AGS (left) and MKN45 (right) cells treated with CBD for 24 h. Cells were collected for western blotting with the indicated antibodies. b AGS cells were treated with 4 μM of CBD for 24 h. Cells were immunostained with anti-XIAP (Red). Images were obtained using a confocal microscope. c , d AGS cells were transfected with myc-XIAP plasmid and treated with 4 μM CBD for 24 h. Apoptosis of cells was determined by flow cytometry ( c ) and immunoblotting ( d ). *** P < 0.001. e , f XIAP was knocked down using siRNA, treated with 4 μM CBD for 24 h, and subjected to flow cytometry ( e ) and west e rn blotting ( f )

Article Snippet: For RNA interference, XIAP siRNA (siXIAP), Smac siRNA (siSmac), and CHOP siRNA (siCHOP) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Western Blot, Microscopy, Transfection, Plasmid Preparation, Flow Cytometry

a Cells were treated with CBD for 24 h. Total mRNA was extracted from cells and mRNA levels of XIAP were assessed by qRT-PCR. b Effect of CBD on XIAP protein stability was determined by performing cycloheximide chase assay. AGS cells were treated with 4 μM CBD and 50 μg/ml cycloheximide at indicated times. Cell lysate was analyzed by western blot analysis. c AGS cells were pre-treated with 5 μM of MG132 then treated with 4 μM of CBD for 24 h. Ubiquitination was detected by immunoblotting. β-Actin was used as a loading control . d 4 μM CBD was treated for various time periods with or without MG132 and analyzed by western blotting. e AGS cells were treated with 4 μM of CBD for 24 h. Cell lysates were immunoprecipitated with IgG or anti-Ub antibodies and immunoblotted for XIAP . f AGS cells were non-treated or pre-treated with 1 μM of MG132 for 1 h and then treated with 4 μM CBD for 24 h. Cell lysates were immunoprecipitated with IgG or anti-Ub antibodies and immunoblotted for XIAP. e The interaction between XIAP and Smac was assessed by Co-IP analysis

Journal: Cell Death & Disease

Article Title: Cannabidiol promotes apoptosis via regulation of XIAP/Smac in gastric cancer

doi: 10.1038/s41419-019-2001-7

Figure Lengend Snippet: a Cells were treated with CBD for 24 h. Total mRNA was extracted from cells and mRNA levels of XIAP were assessed by qRT-PCR. b Effect of CBD on XIAP protein stability was determined by performing cycloheximide chase assay. AGS cells were treated with 4 μM CBD and 50 μg/ml cycloheximide at indicated times. Cell lysate was analyzed by western blot analysis. c AGS cells were pre-treated with 5 μM of MG132 then treated with 4 μM of CBD for 24 h. Ubiquitination was detected by immunoblotting. β-Actin was used as a loading control . d 4 μM CBD was treated for various time periods with or without MG132 and analyzed by western blotting. e AGS cells were treated with 4 μM of CBD for 24 h. Cell lysates were immunoprecipitated with IgG or anti-Ub antibodies and immunoblotted for XIAP . f AGS cells were non-treated or pre-treated with 1 μM of MG132 for 1 h and then treated with 4 μM CBD for 24 h. Cell lysates were immunoprecipitated with IgG or anti-Ub antibodies and immunoblotted for XIAP. e The interaction between XIAP and Smac was assessed by Co-IP analysis

Article Snippet: For RNA interference, XIAP siRNA (siXIAP), Smac siRNA (siSmac), and CHOP siRNA (siCHOP) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Quantitative RT-PCR, Western Blot, Ubiquitin Proteomics, Control, Immunoprecipitation, Co-Immunoprecipitation Assay

a Cells were treated with 4 μM (AGS cells) or 10 μM (MKN45 cells) of CBD for 24 h. Smac expression level was detected by western blotting analysis. b AGS cells were non-treated or pre-treated with 1 μM of MG132 for 1 h and then treated with 4 μM CBD for 24 h. The interaction between XIAP and Smac was determined by Co-IP analysis. c , d AGS cells were transfected with control siRNA (siNC) or Smac siRNA (siSmac). Transfected cells were treated with 4 μM of CBD for 24 h. The protein levels of Smac, XIAP ( c ), and apoptosis-related proteins ( d ) were detected by western blotting. e AGS cells were exposed to CBD for 24 h and then ER stress-related proteins were measured by western blotting. f The cells were transfected with siNC or CHOP-specific siRNA (siCHOP). The transfected cells were treated with 4 μM of CBD for 24 h. Cell lysates were immunoblotted with Smac antibody

Journal: Cell Death & Disease

Article Title: Cannabidiol promotes apoptosis via regulation of XIAP/Smac in gastric cancer

doi: 10.1038/s41419-019-2001-7

Figure Lengend Snippet: a Cells were treated with 4 μM (AGS cells) or 10 μM (MKN45 cells) of CBD for 24 h. Smac expression level was detected by western blotting analysis. b AGS cells were non-treated or pre-treated with 1 μM of MG132 for 1 h and then treated with 4 μM CBD for 24 h. The interaction between XIAP and Smac was determined by Co-IP analysis. c , d AGS cells were transfected with control siRNA (siNC) or Smac siRNA (siSmac). Transfected cells were treated with 4 μM of CBD for 24 h. The protein levels of Smac, XIAP ( c ), and apoptosis-related proteins ( d ) were detected by western blotting. e AGS cells were exposed to CBD for 24 h and then ER stress-related proteins were measured by western blotting. f The cells were transfected with siNC or CHOP-specific siRNA (siCHOP). The transfected cells were treated with 4 μM of CBD for 24 h. Cell lysates were immunoblotted with Smac antibody

Article Snippet: For RNA interference, XIAP siRNA (siXIAP), Smac siRNA (siSmac), and CHOP siRNA (siCHOP) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Expressing, Western Blot, Co-Immunoprecipitation Assay, Transfection, Control

a Tumor growth after subcutaneous injection in an established in vivo tumor xenograft mouse model. ** P < 0.01. b Body weight of mice in the EtOH- and CBD-treated groups. c , d Representative images ( c ) and tumor weight ( d ) of tumor tissues from mice in the control and CBD treatment group. ** P < 0.01. e Tumor sections were stained with TUNEL dye using In Situ TUNEL detection kit. *** P < 0.001. f Tumor tissue sections were immunostained with an anti-XIAP antibody (Red)

Journal: Cell Death & Disease

Article Title: Cannabidiol promotes apoptosis via regulation of XIAP/Smac in gastric cancer

doi: 10.1038/s41419-019-2001-7

Figure Lengend Snippet: a Tumor growth after subcutaneous injection in an established in vivo tumor xenograft mouse model. ** P < 0.01. b Body weight of mice in the EtOH- and CBD-treated groups. c , d Representative images ( c ) and tumor weight ( d ) of tumor tissues from mice in the control and CBD treatment group. ** P < 0.01. e Tumor sections were stained with TUNEL dye using In Situ TUNEL detection kit. *** P < 0.001. f Tumor tissue sections were immunostained with an anti-XIAP antibody (Red)

Article Snippet: For RNA interference, XIAP siRNA (siXIAP), Smac siRNA (siSmac), and CHOP siRNA (siCHOP) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Injection, In Vivo, Control, Staining, TUNEL Assay, In Situ

(A) Representative IHC staining for XIAP and pXIAP proteins in the corpus and the antrum of uninfected mice and ones infected with WT H. pylori strain PMSS1 or its cagE– isogenic mutant for 8 weeks. Insets show magnified views, 40x. Scale bars: 50 μm. Histograms show IHC scores for expression of XIAP and pXIAP proteins (n = 8/group). (B) Western blot analysis of XIAP, pXIAP, and Siva1 proteins in gastric tissues collected from control uninfected mice and ones infected with WT H. pylori strain PMSS1 and its cagE– isogenic mutant for 8 weeks (3 mice/group). Graphs show the densitometric analysis. Western blot analysis of Siva1 protein is also shown in Figure 1B. Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cells

doi: 10.1172/JCI130015

Figure Lengend Snippet: (A) Representative IHC staining for XIAP and pXIAP proteins in the corpus and the antrum of uninfected mice and ones infected with WT H. pylori strain PMSS1 or its cagE– isogenic mutant for 8 weeks. Insets show magnified views, 40x. Scale bars: 50 μm. Histograms show IHC scores for expression of XIAP and pXIAP proteins (n = 8/group). (B) Western blot analysis of XIAP, pXIAP, and Siva1 proteins in gastric tissues collected from control uninfected mice and ones infected with WT H. pylori strain PMSS1 and its cagE– isogenic mutant for 8 weeks (3 mice/group). Graphs show the densitometric analysis. Western blot analysis of Siva1 protein is also shown in Figure 1B. Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001.

Article Snippet: Generation of stable cell lines. shRNA stable cell lines were generated by transfection of AGS cells with control, Siva1, or XIAP shRNA vectors (Santa Cruz Biotechnology), followed by selection with puromycin (2 μg/mL).

Techniques: Immunohistochemistry, Infection, Mutagenesis, Expressing, Western Blot, Control, Comparison

(A) Flow cytometric analysis of apoptosis using Annexin V staining in AGS cells transfected with Siva1 siRNA or scrambled siRNA and then either left uninfected or cocultured with H. pylori strains 7.13 or B128 for 18 hours. The graph panel shows the percentage of apoptotic cells (n = 3). (B) The same as A, but Western blotting was used to analyze cleaved PARP1 and caspase-3 proteins in AGS cells. Cells transfected with scrambled siRNA were used as a control. (C) Flow cytometric analysis of apoptosis using Annexin V staining in AGS cells transfected with pcDNA3-FLAG-Siva1 expression plasmid or empty pcDNA3 vector and then either left uninfected or cocultured with H. pylori strains 7.13 or B128 for 18 hours. The graph panel shows the percentage of apoptotic cells. (D) The same as C, but Western blotting was used to analyze cleaved PARP1 and caspase-3 proteins in AGS cells. Cells transfected with empty vector (pcDNA3) were used as a control. Phosphorylation of CagA was analyzed after coculture of AGS cells with the indicated H. pylori strains for 2 hours. Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SE and are representative of 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001. Representative flow cytometry scatter plots are presented in Supplemental Figure 2. Flow cytometry and Western blot analyses were performed using the same transfected cells. Apoptosis in control cells was caused by transfection. Brackets indicate low and high exposures of Western blot images.

Journal: The Journal of Clinical Investigation

Article Title: Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cells

doi: 10.1172/JCI130015

Figure Lengend Snippet: (A) Flow cytometric analysis of apoptosis using Annexin V staining in AGS cells transfected with Siva1 siRNA or scrambled siRNA and then either left uninfected or cocultured with H. pylori strains 7.13 or B128 for 18 hours. The graph panel shows the percentage of apoptotic cells (n = 3). (B) The same as A, but Western blotting was used to analyze cleaved PARP1 and caspase-3 proteins in AGS cells. Cells transfected with scrambled siRNA were used as a control. (C) Flow cytometric analysis of apoptosis using Annexin V staining in AGS cells transfected with pcDNA3-FLAG-Siva1 expression plasmid or empty pcDNA3 vector and then either left uninfected or cocultured with H. pylori strains 7.13 or B128 for 18 hours. The graph panel shows the percentage of apoptotic cells. (D) The same as C, but Western blotting was used to analyze cleaved PARP1 and caspase-3 proteins in AGS cells. Cells transfected with empty vector (pcDNA3) were used as a control. Phosphorylation of CagA was analyzed after coculture of AGS cells with the indicated H. pylori strains for 2 hours. Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SE and are representative of 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001. Representative flow cytometry scatter plots are presented in Supplemental Figure 2. Flow cytometry and Western blot analyses were performed using the same transfected cells. Apoptosis in control cells was caused by transfection. Brackets indicate low and high exposures of Western blot images.

Article Snippet: Generation of stable cell lines. shRNA stable cell lines were generated by transfection of AGS cells with control, Siva1, or XIAP shRNA vectors (Santa Cruz Biotechnology), followed by selection with puromycin (2 μg/mL).

Techniques: Staining, Transfection, Western Blot, Control, Expressing, Plasmid Preparation, Phospho-proteomics, Comparison, Flow Cytometry

(A) Western blot analysis of Siva1, XIAP, pXIAP(S87), and Cbl-b proteins in AGS cells transfected with the indicated siRNA or scrambled control siRNA and treated as shown at the top of the panel. Low and high exposures are shown. (B) Western blot analysis of Siva1 protein ubiquitination in AGS cells treated as indicated at the top of the panel. Ubiquitination of Siva1 protein was analyzed after its immunoprecipitation with Siva1 antibody. Immunoprecipitation with mouse IgG was used as a control (lane 7). (C) Western blot analysis of XIAP protein phosphorylation at serine 87 after coculture of AGS cells with the indicated H. pylori strains for 4 hours. Each experiment was repeated 3 times, representative data are shown. Brackets indicate low and high exposures of Western blot images.

Journal: The Journal of Clinical Investigation

Article Title: Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cells

doi: 10.1172/JCI130015

Figure Lengend Snippet: (A) Western blot analysis of Siva1, XIAP, pXIAP(S87), and Cbl-b proteins in AGS cells transfected with the indicated siRNA or scrambled control siRNA and treated as shown at the top of the panel. Low and high exposures are shown. (B) Western blot analysis of Siva1 protein ubiquitination in AGS cells treated as indicated at the top of the panel. Ubiquitination of Siva1 protein was analyzed after its immunoprecipitation with Siva1 antibody. Immunoprecipitation with mouse IgG was used as a control (lane 7). (C) Western blot analysis of XIAP protein phosphorylation at serine 87 after coculture of AGS cells with the indicated H. pylori strains for 4 hours. Each experiment was repeated 3 times, representative data are shown. Brackets indicate low and high exposures of Western blot images.

Article Snippet: Generation of stable cell lines. shRNA stable cell lines were generated by transfection of AGS cells with control, Siva1, or XIAP shRNA vectors (Santa Cruz Biotechnology), followed by selection with puromycin (2 μg/mL).

Techniques: Western Blot, Transfection, Control, Ubiquitin Proteomics, Immunoprecipitation, Phospho-proteomics

(A) Western blot analysis of Siva1 protein in AGS cells treated with chemical inhibitors (final concentration 10 μM) for the indicated enzymes and cocultured with H. pylori strain 7.13. The graph panel shows quantification of Siva1 protein by densitometry, normalized to actin (n = 3). Expression of Siva1 protein in control cells treated with vehicle (DMSO) was arbitrarily set at 1. (B) Western blot analysis of Siva1 and XIAP proteins in AGS cells transfected with PI3K siRNA or scrambled siRNA and then either left uninfected or cocultured with H. pylori strain 7.13 for 4 hours (n = 3). (C) The same as B, but siRNA against Akt protein was used (n = 3). Statistical significance was calculated using unpaired 2-tailed t tests and P value corrected by Bonferroni’s multiple comparison adjustment. Data are displayed as mean ± SE and are representative of 3 independent experiments. **P < 0.01; ***P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cells

doi: 10.1172/JCI130015

Figure Lengend Snippet: (A) Western blot analysis of Siva1 protein in AGS cells treated with chemical inhibitors (final concentration 10 μM) for the indicated enzymes and cocultured with H. pylori strain 7.13. The graph panel shows quantification of Siva1 protein by densitometry, normalized to actin (n = 3). Expression of Siva1 protein in control cells treated with vehicle (DMSO) was arbitrarily set at 1. (B) Western blot analysis of Siva1 and XIAP proteins in AGS cells transfected with PI3K siRNA or scrambled siRNA and then either left uninfected or cocultured with H. pylori strain 7.13 for 4 hours (n = 3). (C) The same as B, but siRNA against Akt protein was used (n = 3). Statistical significance was calculated using unpaired 2-tailed t tests and P value corrected by Bonferroni’s multiple comparison adjustment. Data are displayed as mean ± SE and are representative of 3 independent experiments. **P < 0.01; ***P < 0.001.

Article Snippet: Generation of stable cell lines. shRNA stable cell lines were generated by transfection of AGS cells with control, Siva1, or XIAP shRNA vectors (Santa Cruz Biotechnology), followed by selection with puromycin (2 μg/mL).

Techniques: Western Blot, Concentration Assay, Expressing, Control, Transfection, Comparison

(A) Western blot analysis of Siva1 and pXIAP(S87) proteins in AGS cells cotransfected with Siva1, CagA, and GFP expression plasmids at the indicated ratios for 24 hours. GFP was used to normalize transfection efficiency. pXIAP(S87) protein levels were normalized to XIAP protein expression. (B) Western blot analysis of Siva1 and pXIAP(S87) proteins in AGS cells cotransfected with CagA expression vector (CagA-pSP65SRα) or empty vector (pSP65SRα) and Akt siRNA or scrambled siRNA as shown at the top of the panel. β-actin and GFP were used to normalize protein loading and transfection efficiency, respectively. (C) Western blot analysis of Siva1 and pXIAP(S87) proteins in AGS cells cocultured with WT H. pylori strain J166 or its cagA– or cagE– isogenic mutants. The graph panels show quantification of Siva1 and pXIAP(S87) proteins by densitometry, normalized to actin and XIAP, respectively. Expression of Siva1 and pXIAP(S87) proteins in control cells was arbitrarily set at 1. Data were analyzed using 2-tailed Student’s t test. Data are displayed as mean ± SE and are representative of 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cells

doi: 10.1172/JCI130015

Figure Lengend Snippet: (A) Western blot analysis of Siva1 and pXIAP(S87) proteins in AGS cells cotransfected with Siva1, CagA, and GFP expression plasmids at the indicated ratios for 24 hours. GFP was used to normalize transfection efficiency. pXIAP(S87) protein levels were normalized to XIAP protein expression. (B) Western blot analysis of Siva1 and pXIAP(S87) proteins in AGS cells cotransfected with CagA expression vector (CagA-pSP65SRα) or empty vector (pSP65SRα) and Akt siRNA or scrambled siRNA as shown at the top of the panel. β-actin and GFP were used to normalize protein loading and transfection efficiency, respectively. (C) Western blot analysis of Siva1 and pXIAP(S87) proteins in AGS cells cocultured with WT H. pylori strain J166 or its cagA– or cagE– isogenic mutants. The graph panels show quantification of Siva1 and pXIAP(S87) proteins by densitometry, normalized to actin and XIAP, respectively. Expression of Siva1 and pXIAP(S87) proteins in control cells was arbitrarily set at 1. Data were analyzed using 2-tailed Student’s t test. Data are displayed as mean ± SE and are representative of 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.

Article Snippet: Generation of stable cell lines. shRNA stable cell lines were generated by transfection of AGS cells with control, Siva1, or XIAP shRNA vectors (Santa Cruz Biotechnology), followed by selection with puromycin (2 μg/mL).

Techniques: Western Blot, Expressing, Transfection, Plasmid Preparation, Control

Representative IHC staining for Siva1, XIAP, and pXIAP(S87) proteins in gastric biopsies collected from uninfected patients and subjects infected with cagA+ and cagA– H. pylori bacteria. Insets show magnified views, ×40. Scale bars: 50 μm. Histograms show IHC scores for expression of the indicated proteins (n = 32) Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SD. *P < 0.05; ***P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: Bacterial CagA protein compromises tumor suppressor mechanisms in gastric epithelial cells

doi: 10.1172/JCI130015

Figure Lengend Snippet: Representative IHC staining for Siva1, XIAP, and pXIAP(S87) proteins in gastric biopsies collected from uninfected patients and subjects infected with cagA+ and cagA– H. pylori bacteria. Insets show magnified views, ×40. Scale bars: 50 μm. Histograms show IHC scores for expression of the indicated proteins (n = 32) Statistical significance was calculated using 1-way ANOVA followed by Tukey’s multiple comparison test. Data are displayed as mean ± SD. *P < 0.05; ***P < 0.001.

Article Snippet: Generation of stable cell lines. shRNA stable cell lines were generated by transfection of AGS cells with control, Siva1, or XIAP shRNA vectors (Santa Cruz Biotechnology), followed by selection with puromycin (2 μg/mL).

Techniques: Immunohistochemistry, Infection, Bacteria, Expressing, Comparison