92
|
Addgene inc
pbad vector Pbad Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/37-502/pBad+His6+TEV+LIC+cloning+vector+(8B)+(Plasmid+%2337502)/pm39742666-303-7-13 Average 92 stars, based on 1 article reviews
pbad vector - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
90
|
Santa Cruz Biotechnology
anti sgc α1 Anti Sgc α1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/37-502/BTG3+siRNA/pmc09207417-138-46-51 Average 90 stars, based on 1 article reviews
anti sgc α1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
ATCC
amb csp Amb Csp, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/37-502/Fusarium+oxysporum+f%2E+sp%2E+apii+(Nelson+et+Sherbakoff)+Snyder+et+Hansen/pmc03067183-192-74-49 Average 90 stars, based on 1 article reviews
amb csp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
ATCC
ggcggaatagctcagctggctagagcattcggttcatacccgaagtgtcgtaggttcaag tcctatttccgctacca clostridium botulinum a atcc 19397 chr Ggcggaatagctcagctggctagagcattcggttcatacccgaagtgtcgtaggttcaag Tcctatttccgctacca Clostridium Botulinum A Atcc 19397 Chr, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/37-502/pMDIII/pmc07285048__biology___09___00088___s001-6667-58-60 Average 90 stars, based on 1 article reviews
ggcggaatagctcagctggctagagcattcggttcatacccgaagtgtcgtaggttcaag tcctatttccgctacca clostridium botulinum a atcc 19397 chr - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Bio-Techne corporation
cytochrome p450 3a4 antibody (3h8) - bsa free Cytochrome P450 3a4 Antibody (3h8) Bsa Free, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/37-502/Cytochrome+P450+3A4+Antibody+(3H8)+-+BSA+Free/bio-techne+corporation___nbp2-37502 Average 90 stars, based on 1 article reviews
cytochrome p450 3a4 antibody (3h8) - bsa free - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |