1c3 Search Results


94
ATCC rev catgccgcgtgtatgaagaa cgggtaacgtcaatgagcaaa escherichia coli atcc 2441 y
Rev Catgccgcgtgtatgaagaa Cgggtaacgtcaatgagcaaa Escherichia Coli Atcc 2441 Y, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rev catgccgcgtgtatgaagaa cgggtaacgtcaatgagcaaa escherichia coli atcc 2441 y/product/ATCC
Average 94 stars, based on 1 article reviews
rev catgccgcgtgtatgaagaa cgggtaacgtcaatgagcaaa escherichia coli atcc 2441 y - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

90
Developmental Studies Hybridoma Bank anti β 1 2 mannotriose
(A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody <t>(G11.1)</t> specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.
Anti β 1 2 Mannotriose, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti β 1 2 mannotriose/product/Developmental Studies Hybridoma Bank
Average 90 stars, based on 1 article reviews
anti β 1 2 mannotriose - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
Novus Biologicals rat anti mic1 1c3
(A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody <t>(G11.1)</t> specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.
Rat Anti Mic1 1c3, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat anti mic1 1c3/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
rat anti mic1 1c3 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
R&D Systems akr1c3 mouse r d systems
(A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody <t>(G11.1)</t> specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.
Akr1c3 Mouse R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/akr1c3 mouse r d systems/product/R&D Systems
Average 93 stars, based on 1 article reviews
akr1c3 mouse r d systems - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
R&D Systems mouse monoclonal anti akr1c3
(A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody <t>(G11.1)</t> specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.
Mouse Monoclonal Anti Akr1c3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti akr1c3/product/R&D Systems
Average 94 stars, based on 1 article reviews
mouse monoclonal anti akr1c3 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

94
Novus Biologicals macrophage inhibitory cytokine 1 mic1 1c3
(A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody <t>(G11.1)</t> specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.
Macrophage Inhibitory Cytokine 1 Mic1 1c3, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/macrophage inhibitory cytokine 1 mic1 1c3/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
macrophage inhibitory cytokine 1 mic1 1c3 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

86
Novus Biologicals goat anti akr1c3 antibody
Fig. 6. Immunohistochemical localization of <t>AKR1C3</t> in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.
Goat Anti Akr1c3 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti akr1c3 antibody/product/Novus Biologicals
Average 86 stars, based on 1 article reviews
goat anti akr1c3 antibody - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Novus Biologicals millipore mic1
Fig. 6. Immunohistochemical localization of <t>AKR1C3</t> in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.
Millipore Mic1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/millipore mic1/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
millipore mic1 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
R&D Systems anti furin
Fig. 6. Immunohistochemical localization of <t>AKR1C3</t> in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.
Anti Furin, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti furin/product/R&D Systems
Average 90 stars, based on 1 article reviews
anti furin - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
R&D Systems akr1c3 cat 7678 dh 020 was
Fig. 6. Immunohistochemical localization of <t>AKR1C3</t> in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.
Akr1c3 Cat 7678 Dh 020 Was, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/akr1c3 cat 7678 dh 020 was/product/R&D Systems
Average 93 stars, based on 1 article reviews
akr1c3 cat 7678 dh 020 was - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Novus Biologicals agr2 antibody
Fig. 6. Immunohistochemical localization of <t>AKR1C3</t> in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.
Agr2 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agr2 antibody/product/Novus Biologicals
Average 92 stars, based on 1 article reviews
agr2 antibody - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

88
R&D Systems akr1c3 antibody
Figure 2. Proteomic profiling of 361-PBDr cells identified differentially expressed proteins. A, Experimental workflow of the quantitative proteomic profiling. Equal numbers of cells were lysed from duplicate samples of two cell lines. Extracted proteins was digested into tryptic peptides, which were labeled by TMT and analyzed by HPLC-MS/MS. Proteins were subsequently identified and quantified. B, Cellular localization analysis of the identified proteins. C, Volcano plot summarizing protein quantification results of 361-PBDr cells compared with parental cells. Shaded regions indicate DEPs with log2 fold change ≥0.45 or ≤0.45 and significance P < 0.05. D, Quantitative RT-PCR assessed the differential RNA expression in 361-PBDr cells compared with parental cells. Relative mRNA abundance are represented as fold change in 361-PBDr cells compared with parental cells SD from two experiments. E, Western blot analysis demonstrated the differential protein expression of SLFN11, S100A4, <t>AKR1C3,</t> and galectin-1 in resistant 361-PBDr cells compared with parental MDA-MB-361 cells.
Akr1c3 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/akr1c3 antibody/product/R&D Systems
Average 88 stars, based on 1 article reviews
akr1c3 antibody - by Bioz Stars, 2026-04
88/100 stars
  Buy from Supplier

Image Search Results


(A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody (G11.1) specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.

Journal: PLoS ONE

Article Title: Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans

doi: 10.1371/journal.pone.0191194

Figure Lengend Snippet: (A,A’) Yeast cells were grown on the surface of rich (phosphate-replete YPD) nutrient agarose; fluorescent Ywp1-Gfp-Ywp1 was often more abundant in the walls of nascent daughters than in their mother cells. When starved of phosphate by growth to stationary phase in low phosphate BMM13, yeast cells accumulated abundant Ywp1-Gfp-Ywp1 in their walls; when placed in fresh medium, these cells budded daughters with less wall fluorescence (B,B’). A range of Ywp1-Gfp-Ywp1 accumulations arose within the population as phosphate was depleted from growing cultures; phosphate depletion also resulted in reduction in the quantity of phosphodiester-linked mannotriose in the cell wall, as shown by immunolabeling with a monoclonal antibody (G11.1) specific for the mannotriose and a fluorescent red (eFluor660) secondary antibody (C-C”‘). Note the frequent complementarity of signal intensities. Note also that the red signal sometimes appears exterior to the green, possibly resulting from a combination of the mannotriose extending farther from the wall and the double-antibody bridge. Actual width of each image (μm): A: 76; B: 76; C: 54.

Article Snippet: Primary antibodies: Mouse monoclonal: Anti-HA (BAbCO/Covance Research Products MMS-101R; HA.11 clone 16B12; IgG 1 ); anti-β-1,3-glucan (Biosupplies Australia #400–2; IgG 1 ); anti-Gfp (Developmental Studies Hybridoma Bank DSHB-GFP-4C9, -8H11 and -12A6); anti-β-1,2-mannotriose (B6.1 IgM, C3.1 IgG 3 and G11.1 IgG 1 [ – ]).

Techniques: Fluorescence, Immunolabeling

Fig. 6. Immunohistochemical localization of AKR1C3 in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.

Journal: Sexual development : genetics, molecular biology, evolution, endocrinology, embryology, and pathology of sex determination and differentiation

Article Title: Testosterone synthesis in patients with 17β-hydroxysteroid dehydrogenase 3 deficiency.

doi: 10.1159/000336605

Figure Lengend Snippet: Fig. 6. Immunohistochemical localization of AKR1C3 in the testis of patient ARD1853 ( a ) and a normal control ( b ). Leydig cells (white arrowheads) and peritubular cells (yellow arrowheads) show a strong expression of AKR1C3.

Article Snippet: Sections were immunostained with goat anti-AKR1C3 antibody (NB-100–1940, Novus) diluted 1: 160.

Techniques: Immunohistochemical staining, Control, Expressing

Figure 2. Proteomic profiling of 361-PBDr cells identified differentially expressed proteins. A, Experimental workflow of the quantitative proteomic profiling. Equal numbers of cells were lysed from duplicate samples of two cell lines. Extracted proteins was digested into tryptic peptides, which were labeled by TMT and analyzed by HPLC-MS/MS. Proteins were subsequently identified and quantified. B, Cellular localization analysis of the identified proteins. C, Volcano plot summarizing protein quantification results of 361-PBDr cells compared with parental cells. Shaded regions indicate DEPs with log2 fold change ≥0.45 or ≤0.45 and significance P < 0.05. D, Quantitative RT-PCR assessed the differential RNA expression in 361-PBDr cells compared with parental cells. Relative mRNA abundance are represented as fold change in 361-PBDr cells compared with parental cells SD from two experiments. E, Western blot analysis demonstrated the differential protein expression of SLFN11, S100A4, AKR1C3, and galectin-1 in resistant 361-PBDr cells compared with parental MDA-MB-361 cells.

Journal: Molecular Cancer Therapeutics

Article Title: Resistance to Pyrrolobenzodiazepine Dimers Is Associated with SLFN11 Downregulation and Can Be Reversed through Inhibition of ATR

doi: 10.1158/1535-7163.mct-20-0351

Figure Lengend Snippet: Figure 2. Proteomic profiling of 361-PBDr cells identified differentially expressed proteins. A, Experimental workflow of the quantitative proteomic profiling. Equal numbers of cells were lysed from duplicate samples of two cell lines. Extracted proteins was digested into tryptic peptides, which were labeled by TMT and analyzed by HPLC-MS/MS. Proteins were subsequently identified and quantified. B, Cellular localization analysis of the identified proteins. C, Volcano plot summarizing protein quantification results of 361-PBDr cells compared with parental cells. Shaded regions indicate DEPs with log2 fold change ≥0.45 or ≤0.45 and significance P < 0.05. D, Quantitative RT-PCR assessed the differential RNA expression in 361-PBDr cells compared with parental cells. Relative mRNA abundance are represented as fold change in 361-PBDr cells compared with parental cells SD from two experiments. E, Western blot analysis demonstrated the differential protein expression of SLFN11, S100A4, AKR1C3, and galectin-1 in resistant 361-PBDr cells compared with parental MDA-MB-361 cells.

Article Snippet: Membranes were probed with SLFN11 (D2) and CHK1 antibody (Santa Cruz Biotechnology) at 1:100 dilution, orwith S100A4, galectin-1, pCHK1(S345), andb-actin antibodies (Cell Signaling Technology) at 1:1,000 dilutions, or with AKR1C3 antibody (R & D Systems) at 1:500 dilution.

Techniques: Labeling, Tandem Mass Spectroscopy, Quantitative RT-PCR, RNA Expression, Western Blot, Expressing