|
Sino Biological
human trim21 gene orf cdna clone expression plasmid, c-gfpspark tag Human Trim21 Gene Orf Cdna Clone Expression Plasmid, C Gfpspark Tag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/Human+TRIM21+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-GFPSpark+tag/custom%40hg18010-acg%4042066836 Average 93 stars, based on 1 article reviews
human trim21 gene orf cdna clone expression plasmid, c-gfpspark tag - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
MedChemExpress
trim21 ![]() Trim21, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/TRIM21%2C+Human/pmc13178978-237-8-9 Average 94 stars, based on 1 article reviews
trim21 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Huabio Inc
anti trim21 ![]() Anti Trim21, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/anti+monoclonal+rabbit+trim21/pmc13195780-26-0-2 Average 86 stars, based on 1 article reviews
anti trim21 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Azenta
mouse trim21 full length ![]() Mouse Trim21 Full Length, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/cgas+coli+escherichia+expression+full+genes+length+mouse/pm42173883-335-0-28 Average 86 stars, based on 1 article reviews
mouse trim21 full length - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Genechem
trim21 ![]() Trim21, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/knockdown+plasmids+trim21/10__1161_slash_jaha__124__040733-85-8-12 Average 86 stars, based on 1 article reviews
trim21 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
cgaggtgatctcaaagcaata sangon biotech n a shrna trim21 ![]() Cgaggtgatctcaaagcaata Sangon Biotech N A Shrna Trim21, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/a+biotech+cgaggtgatctcaaagcaata+n+sangon+shrna+trim21/pm42054210-663-120-121 Average 86 stars, based on 1 article reviews
cgaggtgatctcaaagcaata sangon biotech n a shrna trim21 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti trim21 ![]() Anti Trim21, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/pmc13047273-317-6-7 Average 86 stars, based on 1 article reviews
anti trim21 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Proteintech
anti trim21 ![]() Anti Trim21, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/TRIM21+Antibody/pmc13047273-317-12-13 Average 96 stars, based on 1 article reviews
anti trim21 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
trim21 antibody ![]() Trim21 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/TRIM21+Rabbit+mAb/pmc13047273-287-9-11 Average 94 stars, based on 1 article reviews
trim21 antibody - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
MedChemExpress
constipation mouse model ![]() Constipation Mouse Model, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trim21/TRIM21%2C+Mouse/pm41913080-49-4-17 Average 94 stars, based on 1 article reviews
constipation mouse model - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
Journal: PLOS Pathogens
Article Title: SARS-CoV-2 Nsp1 suppresses the canonical NF-κB pathway by promoting ubiquitin-dependent degradation of TAK1 kinase
doi: 10.1371/journal.ppat.1014191
Figure Lengend Snippet: a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged TRIM21 (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
Article Snippet: Nsp1 binding kinetics against TAK1 (SinoBiological, #M15-13G) or
Techniques: Transfection, Expressing, Mutagenesis, Plasmid Preparation, Immunoprecipitation, Magnetic Beads, Ubiquitin Proteomics, Construct, Control, shRNA, Luciferase, Selection
Journal: PLOS Pathogens
Article Title: SARS-CoV-2 Nsp1 suppresses the canonical NF-κB pathway by promoting ubiquitin-dependent degradation of TAK1 kinase
doi: 10.1371/journal.ppat.1014191
Figure Lengend Snippet: In uninfected cells (left), TAB1 binds to TAK1, and the TAK1-TAB1 complex phosphorylates downstream regulators, including IκBα, p38, and Erk, which in turn activate the downstream NF-κB, MAPK and AP-1 pathways. In SARS-CoV-2-infected cells (right), Nsp1 binds to TAK1 at the N-terminal TAB1-binding domain, preventing the formation of the TAK1-TAB1 complex and promoting the binding of TRIM21 to the C-terminus of TAK1. As a result, Nsp1 promotes the proteasomal degradation of TAK1 by enhancing the TRIM21-dependent K48-linked polyubiquitination (Ub) of TAK1, thereby attenuating the activity of the NF-κB and AP-1 pathways. Created in BioRender. Yang, Q. (2026) https://BioRender.com/41xkykd .
Article Snippet: Nsp1 binding kinetics against TAK1 (SinoBiological, #M15-13G) or
Techniques: Infection, Binding Assay, Activity Assay
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Expressing, Staining, Control, Western Blot, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Comparison
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Expressing, Knockdown, Sequencing, Phospho-proteomics, Transmission Assay, Electron Microscopy, Fluorescence, Activity Assay, Western Blot
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Sequencing, Western Blot, Co-Immunoprecipitation Assay, Immunofluorescence, Staining, Confocal Microscopy, Microscale Thermophoresis, Over Expression, Knockdown, Phospho-proteomics, Fluorescence
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Ubiquitin Proteomics, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Knockdown, Western Blot, Over Expression, Co-Immunoprecipitation Assay, Modification, Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Mutagenesis
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Functional Assay, Co-Immunoprecipitation Assay, Western Blot, Immunofluorescence, Staining, Confocal Microscopy, Knockdown, Ubiquitin Proteomics, Over Expression
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Ubiquitin Proteomics, Western Blot, Knockdown, Co-Immunoprecipitation Assay, Phospho-proteomics, Activity Assay, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Staining, Comparison
Journal: Research
Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
doi: 10.34133/research.1223
Figure Lengend Snippet: MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
Article Snippet: Sections were prepared and underwent immunohistochemical staining using the
Techniques: Staining, Transmission Assay, Electron Microscopy, Confocal Microscopy, Control, Fluorescence, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Ubiquitin Proteomics