Review





Similar Products

86
Sangon Biotech shrna sequences targeting cherp
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Shrna Sequences Targeting Cherp, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/sequences+shrna/pmc13255054-307-1-8
Average 86 stars, based on 1 article reviews
shrna sequences targeting cherp - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Novogene non targeted metabolomic sequencing
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Non Targeted Metabolomic Sequencing, supplied by Novogene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/analysis+metabolomic+non+targeted/pm42298429-90-32-28
Average 86 stars, based on 1 article reviews
non targeted metabolomic sequencing - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Twist Bioscience twist targeted methylation sequencing workflow
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Twist Targeted Methylation Sequencing Workflow, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/human+methylome+panel+twist/pm42237736-92-8-13
Average 86 stars, based on 1 article reviews
twist targeted methylation sequencing workflow - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech fasn targeting shrna sequences
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Fasn Targeting Shrna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/sequences+shrna/pm42237939-105-0-6
Average 86 stars, based on 1 article reviews
fasn targeting shrna sequences - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

99
Zymo Research bacterial 16s ribosomal rna gene targeted sequencing
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Bacterial 16s Ribosomal Rna Gene Targeted Sequencing, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/16S/pmc12800435-178-9-25
Average 99 stars, based on 1 article reviews
bacterial 16s ribosomal rna gene targeted sequencing - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Sangon Biotech small interfering rna sequences targeting tgf β1
The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of <t>TGF-β1,</t> phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.
Small Interfering Rna Sequences Targeting Tgf β1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/sequences+sirna/pmc13196827-126-1-24
Average 86 stars, based on 1 article reviews
small interfering rna sequences targeting tgf β1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Benchling Inc optimal single guide rna sgrna target sequences
The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of <t>TGF-β1,</t> phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.
Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/guide+rna/pm42167230-305-5-14
Average 86 stars, based on 1 article reviews
optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3

Shperk 2 Targeted Sequence 5 Gttgtgctagcaaccctaata 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/2+3+5+gttgtgctagcaaccctaata+sequence+shperk+targeted/pmc13198297-89-0-8
Average 86 stars, based on 1 article reviews
shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
OriGene human tmprss2 targeting shrna sequences

Human Tmprss2 Targeting Shrna Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/TMPRSS2+Human+shRNA+Plasmid+Kit/pm42156913-285-22-28
Average 94 stars, based on 1 article reviews
human tmprss2 targeting shrna sequences - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

86
Molecular Instruments target mrna sequence information

Target Mrna Sequence Information, supplied by Molecular Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/target+sequence/information+mrna+sequence+target/pmc13171102-215-0-9
Average 86 stars, based on 1 article reviews
target mrna sequence information - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


Cherp serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using shRNA. (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.

Journal: iScience

Article Title: Decoding neuron-specific lineage to identify diagnostic biomarkers and therapeutic targets for ischemic stroke

doi: 10.1016/j.isci.2026.116257

Figure Lengend Snippet: Cherp serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using shRNA. (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.

Article Snippet: The shRNA sequences targeting Cherp were generated at Sangon Biotech.

Techniques: Expressing, Biomarker Discovery, shRNA, Viability Assay, TUNEL Assay, Staining, Functional Assay, Imaging, Fluorescence

The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of TGF-β1, phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of TGF-β1, phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Expressing, Membrane, Western Blot, Immunohistochemistry, Control

Characterization of endothelial progenitor cells (EPCs) and transfection efficacy of small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1). a) was the immunofluorescence result of cluster of differentiation (CD)34 and vascular endothelial growth factor receptor 2 (VEGFR2). b) EPCs could simultaneously absorb DiI-labelled acetylated low-density lipoprotein (Dil-Ac-LDL) and fluorescein isothiocyanate-labeled Ulex europaeus agglutinin I (FITC-UEA-I). Scale bar: 100 μm. c) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. d) Western blot was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the si-TGF-β1 negative control (NC) group; ##p < 0.01, ###p < 0.001 vs the si-TGF-β1 #2 group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: Characterization of endothelial progenitor cells (EPCs) and transfection efficacy of small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1). a) was the immunofluorescence result of cluster of differentiation (CD)34 and vascular endothelial growth factor receptor 2 (VEGFR2). b) EPCs could simultaneously absorb DiI-labelled acetylated low-density lipoprotein (Dil-Ac-LDL) and fluorescein isothiocyanate-labeled Ulex europaeus agglutinin I (FITC-UEA-I). Scale bar: 100 μm. c) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. d) Western blot was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the si-TGF-β1 negative control (NC) group; ##p < 0.01, ###p < 0.001 vs the si-TGF-β1 #2 group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Transfection, Small Interfering RNA, Immunofluorescence, Labeling, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Negative Control

The effect of naringin on the proliferation and viability of endothelial progenitor cells (EPCs). a) 5-ethynyl-2'-deoxyuridine (EdU) staining method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). Scale bar: 100 μm. N = 5/group. b) Cell Counting Kit-8 (CCK-8, Beyotime, China) method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, ** p< 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the proliferation and viability of endothelial progenitor cells (EPCs). a) 5-ethynyl-2'-deoxyuridine (EdU) staining method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). Scale bar: 100 μm. N = 5/group. b) Cell Counting Kit-8 (CCK-8, Beyotime, China) method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, ** p< 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Staining, Cell Counting, CCK-8 Assay, Control, Small Interfering RNA

The effect of naringin on the migration, invasion and tube formation of endothelial progenitor cells (EPCs). a) Scratch wound was used to detect the invasion area of EPCs within 24 hours. Scale bar: 200 μm. b) Transwell assay was used to detect the number of migrated EPCs at 24 hours. Scale bar: 100 μm. c) The tube formation experiment detected the total tube length of EPCs. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). **p < 0.01, ***p < 0.001 vs the control group; ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the migration, invasion and tube formation of endothelial progenitor cells (EPCs). a) Scratch wound was used to detect the invasion area of EPCs within 24 hours. Scale bar: 200 μm. b) Transwell assay was used to detect the number of migrated EPCs at 24 hours. Scale bar: 100 μm. c) The tube formation experiment detected the total tube length of EPCs. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). **p < 0.01, ***p < 0.001 vs the control group; ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Migration, Transwell Assay, Control, Small Interfering RNA

The effect of naringin on angiogenic-osteogenic and transforming growth factor β (TGF-β)/SMAD pathway-related factors of endothelial progenitor cells (EPCs). a) The concentrations of platelet derived growth factor BB (PDGF-BB), vascular endothelial growth factor (VEGF), and slit guidance ligand 3 (SLIT3) in the supernatant of EPCs were detected by enzyme-linked immunosorbent assay. b) Alizarin red staining (ARS) was performed to detect mineralized nodules in osteoblasts. Scale bar: 50 μm. c) The protein level of p-SMAD2 and p-SMAD3 in EPCs was detected by western blot. d) was the immunofluorescence result of p-SMAD2. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the control group; ##p < 0.01, ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on angiogenic-osteogenic and transforming growth factor β (TGF-β)/SMAD pathway-related factors of endothelial progenitor cells (EPCs). a) The concentrations of platelet derived growth factor BB (PDGF-BB), vascular endothelial growth factor (VEGF), and slit guidance ligand 3 (SLIT3) in the supernatant of EPCs were detected by enzyme-linked immunosorbent assay. b) Alizarin red staining (ARS) was performed to detect mineralized nodules in osteoblasts. Scale bar: 50 μm. c) The protein level of p-SMAD2 and p-SMAD3 in EPCs was detected by western blot. d) was the immunofluorescence result of p-SMAD2. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the control group; ##p < 0.01, ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Derivative Assay, Enzyme-linked Immunosorbent Assay, Staining, Western Blot, Immunofluorescence, Control, Small Interfering RNA

Interactions between naringin and transforming growth factor-β1 (TGF-β1). a) The basic chemical structure of naringin. b) 3D and 2D molecular docking patterns of naringin with TGF-β1. c) to g) Results of molecular dynamics simulation analysis illustrating root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), solvent-accessible surface area (SASA), and hydrogen-bond number for the TGF-β1-naringin complexes. h) Representative images of cellular thermal shift assay (CETSA) showing TGF-β1 thermal stability after naringin treatment. i) CETSA curve was performed using GraphPad Prism (GraphPad Software, USA). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the dimethyl sulfoxide (DMSO) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: Interactions between naringin and transforming growth factor-β1 (TGF-β1). a) The basic chemical structure of naringin. b) 3D and 2D molecular docking patterns of naringin with TGF-β1. c) to g) Results of molecular dynamics simulation analysis illustrating root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), solvent-accessible surface area (SASA), and hydrogen-bond number for the TGF-β1-naringin complexes. h) Representative images of cellular thermal shift assay (CETSA) showing TGF-β1 thermal stability after naringin treatment. i) CETSA curve was performed using GraphPad Prism (GraphPad Software, USA). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the dimethyl sulfoxide (DMSO) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Solvent, Thermal Shift Assay, Software

Journal: Cell Reports Medicine

Article Title: Overcoming ADC resistance in advanced colorectal cancer by dual targeting of TROP2 and PERK to suppress Wnt/β-catenin signaling

doi: 10.1016/j.xcrm.2026.102769

Figure Lengend Snippet:

Article Snippet: ShPERK #2 targeted sequence: 5′- GTTGTGCTAGCAACCCTAATA -3′ , Sangon Biotech , N/A.

Techniques: Recombinant, Lysis, Cell Viability Assay, cDNA Synthesis, RNA sequencing, Sequencing, Plasmid Preparation, Software