|
Integrated DNA Technologies
snls-spcas9-snls nuclease Snls Spcas9 Snls Nuclease, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/custom%4010017687%4010%2E1016%2Fj%2Eomton%2E2026%2E201206?v=Integrated+DNA+Technologies Average 93 stars, based on 1 article reviews
snls-spcas9-snls nuclease - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Synthego Inc
spcas9 protein Spcas9 Protein, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/pm42320470-695-23-25?v=Synthego+Inc Average 86 stars, based on 1 article reviews
spcas9 protein - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
alt-r s.p. cas9 v3, glycerol-free Alt R S.P. Cas9 V3, Glycerol Free, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/custom%4010007806%4010%2E1016%2Fj%2Escr%2E2026%2E104040?v=Integrated+DNA+Technologies Average 96 stars, based on 1 article reviews
alt-r s.p. cas9 v3, glycerol-free - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Synthego Inc
design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing Design Optimization Crispr Cas Spcas9 Guide Rna Ggacagaaugaugaaccugg Editing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/pm42269214-46-7-18?v=Synthego+Inc Average 86 stars, based on 1 article reviews
design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
spcas9 Spcas9, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/pm42127894-323-20-21?v=Synthego+Inc Average 86 stars, based on 1 article reviews
spcas9 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
spcas9 2nls nuclease Spcas9 2nls Nuclease, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/pmc13133607-87-39-45?v=Synthego+Inc Average 86 stars, based on 1 article reviews
spcas9 2nls nuclease - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
spcas9 nuclease protein Spcas9 Nuclease Protein, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/pmc13126711-31-39-43?v=Synthego+Inc Average 86 stars, based on 1 article reviews
spcas9 nuclease protein - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Addgene inc
ervin welker Ervin Welker, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/spcas9/pm41896269-176-42-44?v=Addgene+inc Average 91 stars, based on 1 article reviews
ervin welker - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |