Review





Similar Products

93
Integrated DNA Technologies snls-spcas9-snls nuclease
Snls Spcas9 Snls Nuclease, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/custom%4010017687%4010%2E1016%2Fj%2Eomton%2E2026%2E201206?v=Integrated+DNA+Technologies
Average 93 stars, based on 1 article reviews
snls-spcas9-snls nuclease - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

86
Synthego Inc spcas9 protein
Spcas9 Protein, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/pm42320470-695-23-25?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
spcas9 protein - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
Integrated DNA Technologies alt-r s.p. cas9 v3, glycerol-free
Alt R S.P. Cas9 V3, Glycerol Free, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/custom%4010007806%4010%2E1016%2Fj%2Escr%2E2026%2E104040?v=Integrated+DNA+Technologies
Average 96 stars, based on 1 article reviews
alt-r s.p. cas9 v3, glycerol-free - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

86
Synthego Inc design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing
Design Optimization Crispr Cas Spcas9 Guide Rna Ggacagaaugaugaaccugg Editing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/pm42269214-46-7-18?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Synthego Inc spcas9
Spcas9, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/pm42127894-323-20-21?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
spcas9 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Synthego Inc spcas9 2nls nuclease
Spcas9 2nls Nuclease, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/pmc13133607-87-39-45?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
spcas9 2nls nuclease - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Synthego Inc spcas9 nuclease protein
Spcas9 Nuclease Protein, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/pmc13126711-31-39-43?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
spcas9 nuclease protein - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

91
Addgene inc ervin welker
Ervin Welker, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spcas9/pm41896269-176-42-44?v=Addgene+inc
Average 91 stars, based on 1 article reviews
ervin welker - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

Image Search Results