|
Sangon Biotech
ggattgcccatatcacgtcttt sangon biotech n a primer pdk1 reverse Ggattgcccatatcacgtcttt Sangon Biotech N A Primer Pdk1 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pm42054210-662-129-130?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
ggattgcccatatcacgtcttt sangon biotech n a primer pdk1 reverse - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
cctgcacaacctcatcaacaa sangon biotech n a shrna pdk1 Cctgcacaacctcatcaacaa Sangon Biotech N A Shrna Pdk1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pm42054210-663-53-54?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
cctgcacaacctcatcaacaa sangon biotech n a shrna pdk1 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
aggaaccaatgtacttcttgca sangon biotech n a primer pdk1 promoter reverse Aggaaccaatgtacttcttgca Sangon Biotech N A Primer Pdk1 Promoter Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pm42054210-662-10-11?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
aggaaccaatgtacttcttgca sangon biotech n a primer pdk1 promoter reverse - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
ccccgccataccctgtagt sangon biotech n a primer pdk1 forward Ccccgccataccctgtagt Sangon Biotech N A Primer Pdk1 Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pm42054210-662-122-123?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
ccccgccataccctgtagt sangon biotech n a primer pdk1 forward - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Proteintech
cat no 18262 1 ap rrid ab 10598310 Cat No 18262 1 Ap Rrid Ab 10598310, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pmc12995703-3-6-4?v=Proteintech Average 95 stars, based on 1 article reviews
cat no 18262 1 ap rrid ab 10598310 - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Proteintech
pdk1 polyclonal antibody ![]() Pdk1 Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pmc12995703-3-0-4?v=Proteintech Average 95 stars, based on 1 article reviews
pdk1 polyclonal antibody - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti pdk1 ![]() Anti Pdk1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/10__36721_slash_pjps__2026__39__6__167__1-83-18-26?v=Cell+Signaling+Technology+Inc Average 96 stars, based on 1 article reviews
anti pdk1 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Selleck Chemicals
kinase 1 pdk1 inhibitor ![]() Kinase 1 Pdk1 Inhibitor, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/bio_rxiv__64898__2026__03__31__715582-183-10-18?v=Selleck+Chemicals Average 94 stars, based on 1 article reviews
kinase 1 pdk1 inhibitor - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
pdk1 ![]() Pdk1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pm41887382-206-59-61?v=Cell+Signaling+Technology+Inc Average 96 stars, based on 1 article reviews
pdk1 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Proteintech
pdk1 ![]() Pdk1, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pdk1/pm41887382-206-59-68?v=Proteintech Average 95 stars, based on 1 article reviews
pdk1 - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
Journal: iScience
Article Title: Identification and validation of key PANoptosis-related genes via integrative machine learning and single-cell sequencing in AILI
doi: 10.1016/j.isci.2026.115183
Figure Lengend Snippet: Expression and functional exploration of the key genes in single-cell sequencing data (A) The UMAP plot shows the total sample composition, tissue sources, and cell subtypes. (B) The stacked graph shows the proportion of each type of cell in the control group and the AILI group. (C) Bubble plots of marker gene expression demonstrating the accuracy of the cell annotations. (D) Bubble chart showing the expression of Cdkn1a and Pdk1 in various cells in the control group. (E) Bubble chart showing the expression of Cdkn1a and Pdk1 in various cells in the AILI group. (F) Circle plot and heatmap showing the cell communication weights and numbers of all cell subtypes. (G–J) Receptor‒ligand communication weights between AILI and control samples.
Article Snippet:
Techniques: Expressing, Functional Assay, Single Cell, Sequencing, Control, Marker, Gene Expression
Journal: iScience
Article Title: Identification and validation of key PANoptosis-related genes via integrative machine learning and single-cell sequencing in AILI
doi: 10.1016/j.isci.2026.115183
Figure Lengend Snippet: Validation of key PANoptosis-related genes in animal models (A) H&E staining of liver tissues from WT and AILI mice (scale bars, 100 μm; n = 5). (B) mRNA expression of Cdkn1a and Pdk1 by RT-qPCR. (C–F) Correlation analyses between hepatic Cdkn1a and Pdk1 mRNA levels and serum ALT and AST levels at 24 h after AILI. (G) Detection and statistical analysis of key PANoptosis-related gene and marker protein expression in liver tissues from WT and AILI mice. (H) Immunohistochemical staining for P21 and PDK1 in liver tissues from WT and AILI mice (scale bars, 50 μm; n = 5). All the data are presented as the means ± SDs. One-way ANOVA with Tukey’s test and a two-tailed Student’s t test were used for statistical analysis. Spearman’s rank correlation was used to assess the associations between relative mRNA expression levels of Cdkn1a and Pdk1 and serum ALT and AST levels. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001.
Article Snippet:
Techniques: Biomarker Discovery, Staining, Expressing, Quantitative RT-PCR, Marker, Immunohistochemical staining, Two Tailed Test
Journal: iScience
Article Title: Identification and validation of key PANoptosis-related genes via integrative machine learning and single-cell sequencing in AILI
doi: 10.1016/j.isci.2026.115183
Figure Lengend Snippet: Pdk1 knockdown exacerbates AILI by promoting PANoptosis in vivo Mice were assigned to four groups: control, sh- NC , APAP, and sh- Pdk1 + APAP. (A) Schematic illustration of the experimental design. (B) Western blot analysis confirming efficient knockdown of PDK1 protein in liver tissues. (C) Hematoxylin and eosin (H&E) staining of liver sections and quantification of hepatic necrotic areas. Scale bars, 100 μm; n = 5. (D–E) Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. (F) Serum levels of TNF-α, IL-1β, and IL-6 were measured by ELISA. (G) Western blot analysis and quantification of PANoptosis marker proteins in liver tissues. (H–K) Representative immunofluorescence staining of liver sections showing albumin (ALB, green) and PANoptosis marker proteins (ZBP1, p -MLKL, cleaved caspase-1, and cleaved caspase-3; red). Scale bars, 20 μm; n = 5. Data are presented as mean ± SD. One-way ANOVA with Tukey’s test and a two-tailed Student’s t test were used for statistical analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001.
Article Snippet:
Techniques: Knockdown, In Vivo, Control, Western Blot, Staining, Enzyme-linked Immunosorbent Assay, Marker, Immunofluorescence, Two Tailed Test
Journal: bioRxiv
Article Title: Ubiquitin ligase CHFR impairs Tie2 signaling via K 48 -linked ubiquitylation and degradation of Akt1 in endothelial cells
doi: 10.64898/2026.03.31.715582
Figure Lengend Snippet: a-b CHFR deficiency in EC prevents LPS-induced ubiquitylation of Akt1. HLMVEC transfected with sc-siRNA or CHFR-siRNA. At 72 h post-transfection, cells were challenged with LPS (5 μg/ml) for 6 h in the presence of the proteasomal inhibitor MG132 (10 μM). Cell lysates were immunoprecipitated with anti-Akt1 mAb and blotted with antibodies specific to K 48 -linked poly-Ub or K 63 -linked poly-Ub ( n = 2 independent experiments) ( a ). Chfr fl/fl (WT) and Chfr ΔEC mice were challenged with LPS (10 mg/kg; i.p.) for 6 h. After the LPS challenge, lungs harvested were used to determine ubiquitylation of Akt1 as above in a (b) . c-f CHFR induces ubiquitylation of activated Akt1. c Control and CHFR-depleted HLMVEC were pretreated with inhibitors of PDK1 and mTORC2 for 30 min and then exposed to LPS (5 μg/ml). Thereafter, cell lysates were used for IB to assess phosphorylation of Akt1. d-e HLMVEC pretreated with or without PDK1 and mTORC2 inhibitors for 1 h and stimulated with LPS (6 h) in the presence of MG123 (10 μM) showed that CHFR binds and ubiquitylates phosphorylated Akt1. f HEK-293T cells were transfected with HA-tagged ubiquitin (HA-Ub) (0.5 μg/ml) alone or co-transfected with N-terminal GFP-tagged WT-CHFR (1.5 μg/ml), N-terminal pmCherry-tagged WT-Akt1 (1.5 μg/ml), and phosphorylation-defective Akt1 mutant (Akt1T308A/S473A) (1.5 μg/ml) plasmids. Thirty-six hours after transfection, cells were incubated with MG123 (10 μM) for 3h, and cell lysates were used to determine phosphorylation-dependent ubiquitylation of Akt1.
Article Snippet: Mammalian targets of rapamycin (mTOR) inhibitor (catalog #WYE-354), and 3-Phosphoinositide-Dependent
Techniques: Transfection, Immunoprecipitation, Control, Phospho-proteomics, Ubiquitin Proteomics, Mutagenesis, Incubation