Review





Similar Products

human bcl 2  (MedChemExpress)
94
MedChemExpress human bcl 2
Human Bcl 2, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pm41706293-48-4-60?v=MedChemExpress
Average 94 stars, based on 1 article reviews
human bcl 2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
bcl2  (OriGene)
94
OriGene bcl2
Bcl2, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pm41799195-157-51-67?v=OriGene
Average 94 stars, based on 1 article reviews
bcl2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
rabbit anti human bcl2  (Proteintech)
96
Proteintech rabbit anti human bcl2
Rabbit Anti Human Bcl2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pm41759798-65-58-62?v=Proteintech
Average 96 stars, based on 1 article reviews
rabbit anti human bcl2 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier
bcl 2  (OriGene)
94
OriGene bcl 2
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Bcl 2, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pmc12895042-25-0-17?v=OriGene
Average 94 stars, based on 1 article reviews
bcl 2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
bcl  (OriGene)
94
OriGene bcl
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Bcl, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pmc12895042-25-7-17?v=OriGene
Average 94 stars, based on 1 article reviews
bcl - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
polyclonal primary antibody against bcl2  (R&D Systems)
93
R&D Systems polyclonal primary antibody against bcl2
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Polyclonal Primary Antibody Against Bcl2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pm41603924-53-5-10?v=R%26D+Systems
Average 93 stars, based on 1 article reviews
polyclonal primary antibody against bcl2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
bcl2  (Boster Bio)
94
Boster Bio bcl2
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Bcl2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pm41559364-62-91-110?v=Boster+Bio
Average 94 stars, based on 1 article reviews
bcl2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
rabbit anti human bcl 2  (Proteintech)
96
Proteintech rabbit anti human bcl 2
Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and <t>E</t> <t>Bcl-2</t> in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.
Rabbit Anti Human Bcl 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl2/pmc12804270-91-0-14?v=Proteintech
Average 96 stars, based on 1 article reviews
rabbit anti human bcl 2 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Gene Expression, Quantitative RT-PCR, Concentration Assay, Incubation, Control

Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Enzyme-linked Immunosorbent Assay, Concentration Assay, Incubation, Control

Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the gene expression of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using qRT-PCR kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Gene Expression, Quantitative RT-PCR, Concentration Assay, Incubation, Control

Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Journal: Scientific Reports

Article Title: Cubosomal nanoparticles of lycopene as a novel platform for enhancement in antioxidant and anticancer properties with a molecular docking study

doi: 10.1038/s41598-026-36217-7

Figure Lengend Snippet: Effect of Lycopene and Lyc-Cub-NPs on the protein content of A PI3K, B AKT, C mTOR, D Caspase-3, and E Bcl-2 in the HT-29 cell line using ELISA kits on the IC 50 concentration detected by MTT viability test (IC 50 = 95.25 and 54.04 µgml, respectively, incubation for 48 h). Data were expressed as mean ± SD ( n = 3). * means significant versus the control group, and # means significant versus the Lycopene group. Control: cancer cell without any treatments. Each group differed significantly from the others at p ≤ 0.05.

Article Snippet: Bcl-2 , F: ATCGCCCTGTGGATGACTGAGT R: GCCAGGAGAAATCAAACAGAGGC , Bcl-2 Human qPCR Primer Pair ( NM_000633 ), HP200598 , OriGene Technologies, Inc..

Techniques: Enzyme-linked Immunosorbent Assay, Concentration Assay, Incubation, Control