|
OriGene
gapdh Gapdh, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/Gapdh+Mouse+qPCR+Primer+Pair/10__1016_slash_j__jpha__2026__101746-241-24-25 Average 94 stars, based on 1 article reviews
gapdh - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primers for gapdh Primers For Gapdh, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/260183575+gapdh+primers/pmc13138032-55-0-7 Average 86 stars, based on 1 article reviews
primers for gapdh - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer of gapdh Primer Of Gapdh, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/gapdh/pmc13127400-68-0-10 Average 86 stars, based on 1 article reviews
primer of gapdh - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer gapdh f gggtgtgaaccatgagaagt Primer Gapdh F Gggtgtgaaccatgagaagt, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/a+aggtcggtgtgaacggatttg+biotech+gapdh+n+primer+sangon/pmc13018907-35-0-8 Average 86 stars, based on 1 article reviews
primer gapdh f gggtgtgaaccatgagaagt - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer gapdh r cagtgatggcatggactgtg Primer Gapdh R Cagtgatggcatggactgtg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/a+aggtcggtgtgaacggatttg+biotech+gapdh+n+primer+sangon/pmc13018907-36-0-8 Average 86 stars, based on 1 article reviews
primer gapdh r cagtgatggcatggactgtg - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
OriGene
gadph primers Gadph Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/GAPDH+Human+qPCR+Primer+Pair/bio_rxiv__64898__2026__04__01__715918-208-0-2 Average 95 stars, based on 1 article reviews
gadph primers - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
OriGene
origene qstar Origene Qstar, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/Gapdh+Mouse+qPCR+Primer+Pair/pm41881279-119-11-11 Average 94 stars, based on 1 article reviews
origene qstar - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
OriGene
housekeeping gene gapdh Housekeeping Gene Gapdh, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/GAPDH+Human+qPCR+Primer+Pair/pm41844052-417-7-13 Average 95 stars, based on 1 article reviews
housekeeping gene gapdh - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
hs gapdh 1 sg quantitect primer assay qt00079247 qiagen Hs Gapdh 1 Sg Quantitect Primer Assay Qt00079247 Qiagen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+primers/Hs_GAPDH_1_SG+QuantiTect+Primer+Assay+QT00079247+Qiagen/pm41931390-215-271-267 Average 94 stars, based on 1 article reviews
hs gapdh 1 sg quantitect primer assay qt00079247 qiagen - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |