|
Thermo Fisher
gene exp duox1 hs01047827 m1 ![]() Gene Exp Duox1 Hs01047827 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/Gene+Exp%2E+DUOX1%2C+Hs01047827_m1/pmc12297405-402-7--1 Average 94 stars, based on 1 article reviews
gene exp duox1 hs01047827 m1 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Sanofi
utilisation d inhibiteurs de duox1 pour le traitement du cancer ![]() Utilisation D Inhibiteurs De Duox1 Pour Le Traitement Du Cancer, supplied by Sanofi, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/avec+boltes+candiselect+de+de+des+dgalement+ensemencement+et+fournisseur+important+milieux+pdtri+pour+spdcifiques+tels+uriselect/pm40763901-11-9-8 Average 86 stars, based on 1 article reviews
utilisation d inhibiteurs de duox1 pour le traitement du cancer - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
OriGene
duox1 nm 175940 human tagged orf ![]() Duox1 Nm 175940 Human Tagged Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/DUOX1+(NM_175940)+Human+Tagged+ORF+Clone/pmc12338118-145-0-8 Average 93 stars, based on 1 article reviews
duox1 nm 175940 human tagged orf - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
OriGene
duox1 (nm_175940) human tagged orf clone origene rg223832 ![]() Duox1 (Nm 175940) Human Tagged Orf Clone Origene Rg223832, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/duox1++nm+175940++human+tagged+orf+clone+origene+rg223832/pm40537977-132-6-6 Average 90 stars, based on 1 article reviews
duox1 (nm_175940) human tagged orf clone origene rg223832 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Proteintech
duox1 ![]() Duox1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/DUOX1+Antibody/pmc12067898-95-5-14 Average 93 stars, based on 1 article reviews
duox1 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp duox1 hs00213694 m1 ![]() Gene Exp Duox1 Hs00213694 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/Gene+Exp%2E+DUOX1%2C+Hs00213694_m1/pmc12088431__pnas%2E2421747122%2Esapp-277-3-4 Average 87 stars, based on 1 article reviews
gene exp duox1 hs00213694 m1 - by Bioz Stars,
2026-10
87/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp duox1 rn00596688 m1 ![]() Gene Exp Duox1 Rn00596688 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/Gene+Exp%2E+Duox1%2C+Rn00596688_m1/pmc11775830-73-66--1 Average 85 stars, based on 1 article reviews
gene exp duox1 rn00596688 m1 - by Bioz Stars,
2026-10
85/100 stars
|
Buy from Supplier |
|
OriGene
mouse duox1 forward 50 gaagactgcgtcatcaccacag ![]() Mouse Duox1 Forward 50 Gaagactgcgtcatcaccacag, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/duox1/SOX10+(BC002824)+Human+Untagged+Clone/pm39753138-244-70-76 Average 90 stars, based on 1 article reviews
mouse duox1 forward 50 gaagactgcgtcatcaccacag - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: a Schematic of epitope tagged DUOX2 constructs. b DUOX2 transgene expression in H661 cell lines confirmed by immunoblot with anti-HA or anti-DUOX2 antibodies; tubulin served as loading control. c H 2 O 2 generation by H661 cells stably expressing DUOXA2 (control) or DUOXA2 in combination with DUOX2 WT or inactive DUOX2 E843Q, stimulated with thapsigargin/PMA (see “Methods”). d Localization of DUOX2 WT and mutant by immunofluorescent microscopy (HA, red). e Schematic of fluorescently tagged UnaG-DUOX2. f , DUOX2 expression in transfected H661 cells using anti-DUOX2 antibody; vinculin served as loading control. g H 2 O 2 generation by H661 cells transiently transfected with DUOXA2 (control), or DUOXA2 in combination with UnaG-DUOX2 or HA-DUOX2, stimulated with thapsigargin/PMA. h Colocalization of UnaG-DUOX2 signal (green fluorescence) with anti-DUOX antibody staining (red) in fixed cells; inserts show digital magnification of white box area, white arrows indicate plasma membrane localization of UnaG-DUOX2. i Cell surface and vesicular localization of UnaG-DUOX2 in H661 cells; inserts show frames extracted from live cell movie of area denoted by yellow box (Supplementary Movie ). j Co-staining of UnaG-DUOX2 (green) with anti-DUOX antibody (red) on intracellular vesicles in fixed H661 cells, inserts show digital magnification of area denoted by white box, white arrows indicate vesicles. Immunofluorescence staining of DUOX2 (HA, red) localization in ( k ), early endosomes (EEA1, green) and in ( l ), recycling endosomes (SNX4, green) in H661 cells expressing DUOX2 WT; inserts show digital magnification of area denoted by white box, white arrows indicate vesicles, yellow arrow in ( k ) indicates vesicle with DUOX2 lacking EEA1. m Schematic of intracellular DUOX2 vesicle measurements showing colocalized vesicle markers and vesicle sizes (trafficking to plasma membrane 0.6 µm ± 0.3 µm, n = 89; endocytic trafficking 1.4 µm ± 0.6 µm, n = 42). c , g Each point represents a single measurement, n = 3 independent experiments, data are presented as mean ± SD, Brown-Forsythe and Welch ANOVA with Dunnett’s T3 post hoc test; * P < 0.05, **** P < 0.0001. Co-stained with phalloidin for actin ( d green, j purple) and DAPI (blue). d , h , j , k , l Scale bars 10 µm, microscopy analyses representative of n = 5. a , e , m Created in BioRender. Knaus, U. (2025) https://BioRender.com/xgrzcpe , https://BioRender.com/k6zyosb , https://BioRender.com/mnaww5s , modified in Adobe Illustrator.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Construct, Expressing, Western Blot, Control, Stable Transfection, Mutagenesis, Microscopy, Transfection, Fluorescence, Staining, Clinical Proteomics, Membrane, Immunofluorescence, Modification
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: a DUOX2 (HA, red) containing vesicles at tip (insert, yellow arrows) of a nascent TNT in DUOX2 WT expressing H661 cells (actin, green; cortactin, purple). b DUOX (red) containing vesicles in mature TNT connecting two DUOX2 WT expressing H661 cells (white arrow), inserts are digital zoom (actin, green; acetylated α-tubulin, purple). Image is stitched from 2 fields of view on 63X oil objective. c UnaG-DUOX2 (green) localization to the tips of two nascent TNTs (denoted 1 and 2) in H661 cells, co-stained with anti-DUOX antibody (red), actin (purple) and cortactin (light blue). d Quantification of cells with at least one mature connecting TNT in H661 cells expressing DUOXA2 (control), or DUOXA2 combined with DUOX2 WT, or with DUOX2 E843Q, ± 10 µM GKT137831. Each point represents the average of 5 fields of view from 4 experiments, each with 3 replicates, data are presented as mean ± SD, Brown-Forsythe and Welch ANOVA with Dunnett’s T3 post hoc test, **** P < 0.0001. DUOX2 (DUOX e , HA f , g , red) colocalization with RAB11 ( e , purple), Myo10 ( f , purple) and GAP43 ( g , purple) in nascent TNTs in H661 cells expressing DUOX2 WT. h Live cell image of UnaG-DUOX2 vesicles within a TNT in H661 cells, insert shows digital zoom of area denoted by white arrow. i Localization of UnaG-DUOX2 within transport vesicles along a TNT during live cell imaging of H661 cells expressing UnaG-DUOX2, insert shows digital zoom of area denoted by white arrow (Supplementary Movie ). j Scheme of membrane embedded HyPer7-MEM oxidation by DUOX2. k , H O generation at the tip of an extending TNT with HyPer7 signal colocalizing with DUOX2 (HA, red) in fixed DUOX2 WT expressing H661 cells. l Live cell confocal video microscopy image of HyPer7 signal peaks in vesicles and at the tip of an unattached TNT in DUOX2 WT expressing H661 cells, inserts show digital zoom of TNT indicated by white arrow (Supplementary Movie ). m DUOX2 (HA, red) localization to apical double ring protrusions with actin (green) and cortactin (purple). White arrows denote apical surface protrusions, digital zoom of arrow A shown in inserts. n 3D rendering of z-stack from ( m ), white arrows indicate apical protrusions, yellow box expands to x/y projection of z-stack indicating protrusion distance. o Maximum projection z-stack of DUOX2 WT and HyPer7-MEM expressing H661 cells, indicating DUOX2 (HA, red) and HyPer7 (green and heatmap) localization in an apical protrusion. Inserts show a digital zoom of the white box with z-slices visualizing DUOX2 and H O generation throughout an apical protrusion. a–c , e–i , k , Cells serum starved for 24 h before fixation or live cell imaging. m–o Cells incubated in murine fibroblast conditioned media for 24 h pre-fixation. k , o HyPer7 presented as green for merged image and as a heatmap (HyPer7 pixel intensity) in inserts to visualize H O peaks. Scale bars a – c , e – h , k – o 10 µm, i 100 µm, microscopy analyses representative of n = 5. j Created in BioRender. Knaus, U. (2025) https://BioRender.com/fodhypa , modified in Adobe Illustrator.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Expressing, Staining, Control, Live Cell Imaging, Membrane, Microscopy, Incubation, Modification
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: a DUOX2 and DUOXA2 expression in untreated or IFNγ (10 ng/ml) / LPS (100 ng/ml) treated (24 h) BxPC3 cells. Each point represents the mean ∆Ct ± SD of one measurement from 3 technical replicates, taken from 3 independent experiments. b DUOX2 expression in BxPC3 cells with and without IFNγ/LPS pretreatment. c H 2 O 2 generation by BxPC3 cells with and without IFNγ/LPS pretreatment, either unstimulated or after stimulation with PMA/thapsigargin. d , e CRISPR-mediated ablation of DUOX2 or DUOX1/2 from DUOX1/2 WT BxPC3 cells shown by d , immunoblot in indicated conditions and e , by microscopy (DUOX, red; actin, green; scale bar 10 µm, microscopy analyses representative of n = 5). f H 2 O 2 generation by DUOX1/2 WT, DUOX2 KO and DUOX1/2 KO BxPC3 cell lines, ±24 h pre-stimulation by IFNγ/LPS, all conditions stimulated with PMA/thapsigargin. b , d Actin served as loading control. c , f Data are presented as mean ± SD, Brown-Forsythe and Welch ANOVA with Dunnett’s T3 post hoc test; *** P < 0.0005, **** P < 0.0001, n = 3 biological replicates each with 3 technical replicates.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Expressing, CRISPR, Western Blot, Microscopy, Control
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: Localization of DUOX2 to extending lamellipodia in ( a ), DUOX2 WT expressing H661 cells (DUOX2 (HA, red); multiple lamellipodia denoted by white arrows) and in ( b ), BxPC3 DUOX1/2 WT cells (DUOX, red), inserts show spilt channels DUOX (red, top) and actin (green, bottom). c DUOX2 (HA, red) localized to a nascent lamellipodia, white arrow, colocalizing with cortactin (purple) and actin (green) in a typified lattice structure, inserts show split channel digital zoom of lamellipodia formation. d Localization of UnaG-DUOX2 (white) during lamellipodia formation; frames extracted from live cell confocal video microscopy at indicated time points (Supplementary Movie ). e Kymograph analysis of lamellipodia protrusion velocity in control and DUOX2 WT expressing H661 cells, each point represents a single lamellipodia from separate cells across 3 independent experiments, Welch’s t test, *** P < 0.005. Single cell migration velocity in f , H661 and g , BxPC3 cell lines, n = each point represents the average from 3 independent experiments with 25 cells tracked per experiment; Brown-Forsythe and Welch ANOVA with Dunnett’s T3 post hoc test * P < 0.05, ** P < 0.005. h H 2 O 2 generation at the leading edge and rear retraction zone in migrating DUOX1/2 WT BxPC3 cells expressing HyPer7-MEM. Still images extracted from live cell video microscopy (Supplementary Movie ). i PIEZO1 (purple) staining in H661 DUOX2 WT cells, colocalized with DUOX2 (red) at the leading edge of a lamellipodia, co-stained with actin (green), digital zoom of lamellipodia at white arrow highlighting colocalization. j Colocalization of DUOX (red) and PIEZO1 (purple) in DUOX1/2 WT BxPC3 cells; digital zoom of area denoted by white box highlighting colocalization at protrusions. k Single cell migration velocity in DUOX1/2 WT BxPC3 cells ± GsMTx4 (5 µM), n = each point represents the average from 3 independent experiments with 25 cells tracked per experiment, Welch’s t test, *** P < 0.005. e–g , k Data are presented as mean ± SD; a – c , i , j , co-stained with DAPI (blue). a–d , h – j Scale bars 10 µm, microscopy analyses representative of n = 5.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Expressing, Microscopy, Control, Migration, Staining
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: a Colocalization of DUOX2 (HA, red), FER (purple) and HyPer7-MEM (green) on intracellular vesicles in H661 DUOX2 WT cells; insert shows digital zoom with vesicles at white arrows. b DUOX2 (HA, red) and FER (purple) plasma membrane colocalization in DUOX2 WT expressing H661 cells. c Plasma membrane colocalization of DUOX2 (HA, red) and FER (purple) with HyPer7 pixel intensity heatmap in H661 DUOX2 WT cells. d Single cell migration velocity in DUOX1/2 WT BxPC3 cells ± FER inhibition (E260 5 µM), n = each point represents the average from 3 independent experiments with 25 cells tracked per experiment, Welch’s t test, * P < 0.05. e Immunoprecipitation (IP) of FER from H661 cell lysates to assess both pY-FER and FER-DUOX2 interaction with and without DUOX2 stimulation (thapsigargin 1 µM, 1 h). Antibodies used for immunoblotting (IB) are indicated. f Densitometry analysis of pY FER from FER IPs in H661 cells, each point represents a single replicate, each point represents 4 separate analyses, Welch’s t test, p values displayed on graph. g DUOX2 (HA, red) and phospho-Cortactin (purple) membrane colocalization in DUOX2 WT expressing H661 cells. h Colocalization of DUOX2 (HA, red) and phospho-Cortactin (purple) in lamellipodia (white arrow) at sites of active H 2 O 2 generation (HyPer7 signal). Quantification of F-Actin using G-Actin/F-Actin determination in BxPC3 ( i ) and H661 ( j ) cell lines as indicated; each point represents one technical replicate from 3 independent experiments. i Welch’s t test, *** P < 0.0005, j Brown-Forsythe and Welch ANOVA with Dunnett’s T3 post hoc test, ** P < 0.005. d , f , i , j Data are presented as mean ± SD, a , c , h , HyPer7 presented as green for merged image and as heatmap (HyPer7 pixel intensity) in inserts to visualize H 2 O 2 peaks. Scale bars 10 µm, microscopy analyses representative of n = 5.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Clinical Proteomics, Membrane, Expressing, Migration, Inhibition, Immunoprecipitation, Western Blot, Microscopy
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: a Experimental design for wound healing analysis. b Cell front speed during barrier assay (IBIDI inserts) by BxPC3 DUOX1/2 WT (blue), DUOX2 KO (red), and DUOX1/2 KO (purple) cell lines, observed for 24 h. c Cell front speed during scratch assays in BxPC3 DUOX1/2 WT (blue), DUOX2 KO (red), and DUOX1/2 KO (purple) cell lines, observed for 24 h, numbers indicate peaks in BxPC3 DUOX1/2 WT cells that represent cell front retraction (1) and cell front extension (2). d Individual frames extracted from wound healing movies in BxPC3 DUOX1/2 WT cells (upper panels) and BxPC3 DUOX1/2 KO cells (lower panels) depicting differences in wound closure dynamics. Green lines represent wound edges at t = 0 h, red lines represent wound edges at indicated timepoints (Supplementary Movie ) e Cell front speed in scratch assays in BxPC3 DUOX1/2 WT cells either untreated (blue) or in the presence of NOX/DUOX inhibitor GKT137831 (10 µM, orange) or the cell permeant calcium chelator BAPTA-AM (20 µM, green). Cell front speed ( f ) and change in wound width (% of initial wound) ( g ) in BxPC3 DUOX1/2 WT or DUOX1/2 KO cell lines ± addition of exogenous H 2 O 2 (25 µM) in scratch assays. h Fixed cell immunofluorescent staining of BxPC3 DUOX1/2 WT HyPer7-MEM cells, showing DUOX (red), HyPer7 (heatmap), and actin (purple), coverslips were fixed at the indicated timepoints post wounding. b , c , e , f , g , n = each point represents the average speed or wound area every 3 h, from 3 independent experiments, each with 6 replicates. d , h Scale bars 100 µm, microscopy analyses representative of n = 5. a Created in BioRender. Knaus, U. (2025) https://BioRender.com/1rsz4wv , modified in Adobe Illustrator.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Staining, Microscopy, Modification
Journal: Nature Communications
Article Title: Spatiotemporal H 2 O 2 flashes coordinate actin cytoskeletal remodeling and regulate cell migration and wound healing
doi: 10.1038/s41467-025-62272-1
Figure Lengend Snippet: a FER (red) localization during wound healing in BxPC3 DUOX1/2 WT HyPer7-MEM cells, HyPer7 (merge, green; or intensity heatmap) and actin (purple), coverslips were fixed at the indicated timepoints post wounding. Cell front speed ( b ) and change in wound area ( c ) in BxPC3 DUOX1/2 and DUOX1/2 KO cell lines ± FER inhibition (E260 20 µM). d Colocalization of PIEZO1 (purple) and FER (red) at the wound edge during scratch assay in fixed BxPC3 DUOX1/2 WT cells. e Colocalization of PIEZO1 (purple) and DUOX (red) at the wound edge in fixed BxPC3 DUOX1/2 WT cells. f Cell front speed during PIEZO1 stimulation (Yoda1 5 µM) or calcium channel inhibition (GsMTx4 5 µM) in BxPC3 DUOX1/2 WT cells (blue, Yoda1; light blue, GsMTx4) or BxPC3 DUOX1/2 KO cells (red, Yoda1; light red, GsMTx4). Brightfield frames extracted from live cell scratch assay movies showing time-dependent wound closure for ( g ), Yoda1-treated BxPC3 DUOX1/2 KO cells, red arrows indicate areas of cell front arrest (Supplementary Movie ), and h , GsMTx4-treated BxPC3 DUOX1/2 WT cells, green lines indicate initial wound edges at t = 0 h, red lines indicate wound edges at the indicated timepoints, red arrows show area of damaged cells. i Brightfield images extracted from live cell scratch assays at indicated timepoints, see elimination of damaged cell front in BxPC3 DUOX1/2 WT cells (upper panels, green arrows) and inefficient incorporation of the damaged cell front in BxPC3 DUOX1/2 KO cells (lower panels, red arrows). j Analysis of monolayer permeability using FITC-dextran (4 kDa) in BxPC3 DUOX1/2 WT (blue) and DUOX1/2 KO (red) cell lines for 24 h pre-wound followed by measurements at 3 h, 26 h, and 50 h post wounding, individual Welch’s t test at each time point, * P < 0.05. Each point represents the average from 3 independent experiments, each with 3 replicates, Data are presented as mean ± SEM. k , Scheme of PIEZO1-DUOX2-FER engagement during wound healing. b , c , f , n = each point represents the average cell front speed or wound area for every 3 h from 3 independent experiments, each with 6 replicates. a , d , e , g , h , i Scale bars 100 µm, microscopy analyses representative of n = 5. k Created in BioRender. Knaus, U. (2025) https://BioRender.com/putget1 , modified in Adobe Illustrator.
Article Snippet: The following TaqMan probes were used: DUOX1
Techniques: Inhibition, Wound Healing Assay, Permeability, Microscopy, Modification