Review





Similar Products

86
Meira Corporation double spike plate
Double Spike Plate, supplied by Meira Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pmc13273478-106-9-11?v=Meira+Corporation
Average 86 stars, based on 1 article reviews
double spike plate - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Pfizer Inc spike ab igg
Spike Ab Igg, supplied by Pfizer Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pmc08806103-59-0-15?v=Pfizer+Inc
Average 86 stars, based on 1 article reviews
spike ab igg - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech spike in template f
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pmc13142104-80-0-10?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
spike in template f - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech spike in template r
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pmc13142104-81-0-10?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
spike in template r - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Clinisciences spike protein trimer d614g
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike Protein Trimer D614g, supplied by Clinisciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pm42269600-57-0-7?v=Clinisciences
Average 86 stars, based on 1 article reviews
spike protein trimer d614g - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Cambridge Electronic Design ced spike 5 software
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Ced Spike 5 Software, supplied by Cambridge Electronic Design, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pm42263267-119-22-26?v=Cambridge+Electronic+Design
Average 86 stars, based on 1 article reviews
ced spike 5 software - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

99
MyoLearn electromyography (emg) research
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Electromyography (Emg) Research, supplied by MyoLearn, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/custom-emg-10%2E1016%2Fj%2Eynirp%2E2026%2E100353?v=MyoLearn
Average 99 stars, based on 1 article reviews
electromyography (emg) research - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

86
Cambridge Electronic Design spike 2 software version 10 19
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike 2 Software Version 10 19, supplied by Cambridge Electronic Design, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pm42171607-244-10-15?v=Cambridge+Electronic+Design
Average 86 stars, based on 1 article reviews
spike 2 software version 10 19 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Twist Bioscience xfg spike gene
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Xfg Spike Gene, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pm42149970-166-1-10?v=Twist+Bioscience
Average 86 stars, based on 1 article reviews
xfg spike gene - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Cambridge Electronic Design algorithms spike 2 cambridge electronic design limited
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Algorithms Spike 2 Cambridge Electronic Design Limited, supplied by Cambridge Electronic Design, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike/pm42161267-731-267-270?v=Cambridge+Electronic+Design
Average 86 stars, based on 1 article reviews
algorithms spike 2 cambridge electronic design limited - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription

Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template R , TTTTTTTCTCGACTGAAATGCTTAGAT GACCCAGCCCTCAATAGGGCCGCCT CGGCCNNNTGNNNACNNNATNNNG CNNNTGNNNACNNNGGCCGTAATG GCCGGTACCTTA , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription