|
Hycult Biotech
cpg b odn2006 Cpg B Odn2006, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/CpG-B+DNA+(ODN+2006)%2C+Human%2F+Mouse/10__1186_slash_s12967___026___08773___z-64-63-65 Average 94 stars, based on 1 article reviews
cpg b odn2006 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg Cpg, supplied by InvivoGen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+2006/pm42805178-286-45-46 Average 97 stars, based on 1 article reviews
cpg - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg dna Cpg Dna, supplied by InvivoGen, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+1826/pm42778610-594-39-42 Average 98 stars, based on 1 article reviews
cpg dna - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg odn 1668 Cpg Odn 1668, supplied by InvivoGen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+1668/10__1038_slash_s41467___026___77588___9-504-33-35 Average 97 stars, based on 1 article reviews
cpg odn 1668 - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg b Cpg B, supplied by InvivoGen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+1668/pm42722588-89-50-52 Average 97 stars, based on 1 article reviews
cpg b - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg odn 5 tccatgacgttcctgacgtt 3 Cpg Odn 5 Tccatgacgttcctgacgtt 3, supplied by InvivoGen, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+1826/pmc13639900-1232-0-4 Average 98 stars, based on 1 article reviews
cpg odn 5 tccatgacgttcctgacgtt 3 - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg odn 2395 Cpg Odn 2395, supplied by InvivoGen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+2395/10__3390_slash_vaccines14090793-63-13-17 Average 97 stars, based on 1 article reviews
cpg odn 2395 - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
InvivoGen
inflammation cpg oligodeoxynucleotides Inflammation Cpg Oligodeoxynucleotides, supplied by InvivoGen, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+1826/pm42705538-157-4-10 Average 98 stars, based on 1 article reviews
inflammation cpg oligodeoxynucleotides - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
|
InvivoGen
cpg odn 1826 Cpg Odn 1826, supplied by InvivoGen, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cpg+odn/ODN+1826/pm42463806-357-5-12 Average 98 stars, based on 1 article reviews
cpg odn 1826 - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |